EMAIL THIS PAGE TO A FRIEND

CDHR3

cadherin-related family member 3

137 Gene Product Result for
Synonyms: CDH28
UniProtKB ID: Q6ZTQ4, Q8TCI7
Gene ID:
Mouse(68764) cadherin-related family member 3
domestic guinea pig(100720876) cadherin-related family member 3
naked mole-rat(101710142) cadherin-related family member 3
sheep(101104990) cadherin-related family member 3
chicken(427846) cadherin-related family member 3
dog(475891) cadherin-related family member 3
Horse(100059168) cadherin-related family member 3
cow(786198) cadherin-related family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152750 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152750 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152750 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152750 Rosetta Predictions human pricing
NM_001024478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056245 predicted 509
2 SASI_Hs01_00056246 predicted 577
3 SASI_Hs01_00056247 predicted 2386
4 SASI_Hs02_00366670 predicted 1001
5 SASI_Hs01_00056248 predicted 2481
6 SASI_Hs01_00056249 predicted 622
7 SASI_Hs01_00056250 predicted 491
8 SASI_Hs01_00056251 predicted 1767
9 SASI_Hs01_00056252 predicted 2227
10 SASI_Hs01_00056253 predicted 1123
11 SASI_Hs01_00056244 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287590 predicted 512
2 SASI_Mm01_00059091 predicted 398
3 SASI_Mm01_00059093 predicted 936
4 SASI_Mm01_00059094 predicted 1924
5 SASI_Mm01_00059095 predicted 616
6 SASI_Mm01_00059096 predicted 1422
7 SASI_Mm01_00059097 predicted 2679
8 SASI_Mm02_00287591 predicted 237
9 SASI_Mm01_00059098 predicted 2497
10 SASI_Mm01_00059099 predicted 236
11 SASI_Mm01_00059090 predicted 2619
12 SASI_Mm01_00059092 predicted 1356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152750
CDHR3 MISSION shRNA Bacterial Glycerol Stock
cadherin-related family member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-1061s1c1
Sequence:CCGGCGCATCCAGATAACCTTCATTCTCGAGAATGAAGGTTATCTGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-1901s1c1
Sequence:CCGGCCAGGTAACGTCAACAATCATCTCGAGATGATTGTTGACGTTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-1175s1c1
Sequence:CCGGGACCTAAACAAGTTCTGCTTTCTCGAGAAAGCAGAACTTGTTTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-2212s1c1
Sequence:CCGGCGTGCCGTTTGTCATCACTTTCTCGAGAAAGTGATGACAAACGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-585s1c1
Sequence:CCGGCCCTCAGTTATTTCCTGATTTCTCGAGAAATCAGGAAATAACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-797s21c1
Sequence:CCGGACGACGAAGTCCCTCGCTTTACTCGAGTAAAGCGAGGGACTTCGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-1365s21c1
Sequence:CCGGTAACCTAGCAGCCGGCAATAACTCGAGTTATTGCCGGCTGCTAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-2420s21c1
Sequence:CCGGTCCAGATGAACACTATCTTTGCTCGAGCAAAGATAGTGTTCATCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-2289s21c1
Sequence:CCGGCGTGTACCTGGTCGTCCTATTCTCGAGAATAGGACGACCAGGTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-1803s21c1
Sequence:CCCGTTGTACTCCAAACTCTTATTTCTCGAGAAATAAGAGTTTGGAGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152750
CDHR3 MISSION shRNA shRNA Plasmid DNA
cadherin-related family member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-1061s1c1
Sequence:CCGGCGCATCCAGATAACCTTCATTCTCGAGAATGAAGGTTATCTGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-1901s1c1
Sequence:CCGGCCAGGTAACGTCAACAATCATCTCGAGATGATTGTTGACGTTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-1175s1c1
Sequence:CCGGGACCTAAACAAGTTCTGCTTTCTCGAGAAAGCAGAACTTGTTTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-2212s1c1
Sequence:CCGGCGTGCCGTTTGTCATCACTTTCTCGAGAAAGTGATGACAAACGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-585s1c1
Sequence:CCGGCCCTCAGTTATTTCCTGATTTCTCGAGAAATCAGGAAATAACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-797s21c1
Sequence:CCGGACGACGAAGTCCCTCGCTTTACTCGAGTAAAGCGAGGGACTTCGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-1365s21c1
Sequence:CCGGTAACCTAGCAGCCGGCAATAACTCGAGTTATTGCCGGCTGCTAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-2420s21c1
Sequence:CCGGTCCAGATGAACACTATCTTTGCTCGAGCAAAGATAGTGTTCATCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-2289s21c1
Sequence:CCGGCGTGTACCTGGTCGTCCTATTCTCGAGAATAGGACGACCAGGTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-1803s21c1
Sequence:CCCGTTGTACTCCAAACTCTTATTTCTCGAGAAATAAGAGTTTGGAGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152750
CDHR3 MISSION shRNA Lentiviral Transduction Particles
cadherin-related family member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-1061s1c1
Sequence:CCGGCGCATCCAGATAACCTTCATTCTCGAGAATGAAGGTTATCTGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-1901s1c1
Sequence:CCGGCCAGGTAACGTCAACAATCATCTCGAGATGATTGTTGACGTTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-1175s1c1
Sequence:CCGGGACCTAAACAAGTTCTGCTTTCTCGAGAAAGCAGAACTTGTTTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-2212s1c1
Sequence:CCGGCGTGCCGTTTGTCATCACTTTCTCGAGAAAGTGATGACAAACGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152750.2-585s1c1
Sequence:CCGGCCCTCAGTTATTTCCTGATTTCTCGAGAAATCAGGAAATAACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-797s21c1
Sequence:CCGGACGACGAAGTCCCTCGCTTTACTCGAGTAAAGCGAGGGACTTCGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-1365s21c1
Sequence:CCGGTAACCTAGCAGCCGGCAATAACTCGAGTTATTGCCGGCTGCTAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-2420s21c1
Sequence:CCGGTCCAGATGAACACTATCTTTGCTCGAGCAAAGATAGTGTTCATCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-2289s21c1
Sequence:CCGGCGTGTACCTGGTCGTCCTATTCTCGAGAATAGGACGACCAGGTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152750.4-1803s21c1
Sequence:CCCGTTGTACTCCAAACTCTTATTTCTCGAGAAATAAGAGTTTGGAGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024478
CDHR3 MISSION shRNA Bacterial Glycerol Stock
cadherin-related family member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024478.1-2618s1c1
Sequence:CCGGCCACTATTCTCTTCATCGTTACTCGAGTAACGATGAAGAGAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024478.1-2576s1c1
Sequence:CCGGCCCTAAACACACAGGGAGATACTCGAGTATCTCCCTGTGTGTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024478.1-767s1c1
Sequence:CCGGCCAGGTGACTATTGTGAACATCTCGAGATGTTCACAATAGTCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024478.1-1026s1c1
Sequence:CCGGCCCATCATTTCTCTGGAAGTTCTCGAGAACTTCCAGAGAAATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024478.1-1142s1c1
Sequence:CCGGGCTCACTTTCAGCATTATGTTCTCGAGAACATAATGCTGAAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024478
CDHR3 MISSION shRNA shRNA Plasmid DNA
cadherin-related family member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024478.1-2618s1c1
Sequence:CCGGCCACTATTCTCTTCATCGTTACTCGAGTAACGATGAAGAGAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024478.1-2576s1c1
Sequence:CCGGCCCTAAACACACAGGGAGATACTCGAGTATCTCCCTGTGTGTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024478.1-767s1c1
Sequence:CCGGCCAGGTGACTATTGTGAACATCTCGAGATGTTCACAATAGTCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024478.1-1026s1c1
Sequence:CCGGCCCATCATTTCTCTGGAAGTTCTCGAGAACTTCCAGAGAAATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024478.1-1142s1c1
Sequence:CCGGGCTCACTTTCAGCATTATGTTCTCGAGAACATAATGCTGAAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024478
CDHR3 MISSION shRNA Lentiviral Transduction Particles
cadherin-related family member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024478.1-2618s1c1
Sequence:CCGGCCACTATTCTCTTCATCGTTACTCGAGTAACGATGAAGAGAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024478.1-2576s1c1
Sequence:CCGGCCCTAAACACACAGGGAGATACTCGAGTATCTCCCTGTGTGTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024478.1-767s1c1
Sequence:CCGGCCAGGTGACTATTGTGAACATCTCGAGATGTTCACAATAGTCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024478.1-1026s1c1
Sequence:CCGGCCCATCATTTCTCTGGAAGTTCTCGAGAACTTCCAGAGAAATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024478.1-1142s1c1
Sequence:CCGGGCTCACTTTCAGCATTATGTTCTCGAGAACATAATGCTGAAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks