EMAIL THIS PAGE TO A FRIEND

CDHR4

cadherin-related family member 4

Synonyms: CDH29 PRO34300
UniProtKB ID: A6H8M9, Q6UXT0
Gene ID:
Mouse(69398) cadherin-related family member 4
Rat(363144) cadherin-related family member 4
chicken(101668721) cadherin-related family member 4
chicken(101749086) cadherin-related family member 4
cow(786520) cadherin-related family member 4
Horse(100062606) cadherin-related family member 4
domestic cat(101088312) cadherin-related family member 4
dog(476621) cadherin-related family member 4
sheep(101102094) cadherin-related family member 4
Domestic Rabbit(100358424) cadherin-related family member 4
naked mole-rat(101718817) cadherin-related family member 4
domestic guinea pig(100731319) cadherin-related family member 4
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007540 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017791 MISSION® esiRNA esiRNA targeting human CDH29 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007540 Rosetta Predictions human pricing
XM_001074750 Rosetta Predictions rat pricing
XM_343481 Rosetta Predictions rat pricing
NM_001122635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045319 predicted 589
2 SASI_Hs01_00045320 predicted 266
3 SASI_Hs02_00305334 predicted 388
4 SASI_Hs01_00045321 predicted 346
5 SASI_Hs01_00045322 predicted 240
6 SASI_Hs01_00045323 predicted 328
7 SASI_Hs01_00045324 predicted 264
8 SASI_Hs02_00305335 predicted 391
9 SASI_Hs01_00045326 predicted 306
10 SASI_Hs01_00045327 predicted 319
11 SASI_Hs01_00045325 predicted 292
12 SASI_Hs01_00045328 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347234 predicted 999
2 SASI_Rn02_00347235 predicted 1903
3 SASI_Rn02_00347236 predicted 1958
4 SASI_Rn02_00347237 predicted 852
5 SASI_Rn02_00347238 predicted 812
6 SASI_Rn02_00347239 predicted 1893
7 SASI_Rn02_00347240 predicted 1617
8 SASI_Rn02_00347241 predicted 1820
9 SASI_Rn02_00347242 predicted 1579
10 SASI_Rn02_00347243 predicted 1732
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395824 predicted 1002
2 SASI_Rn02_00395825 predicted 2207
3 SASI_Rn02_00395826 predicted 1903
4 SASI_Rn02_00395827 predicted 1962
5 SASI_Rn02_00395828 predicted 1896
6 SASI_Rn02_00395829 predicted 1002
7 SASI_Rn02_00395830 predicted 1620
8 SASI_Rn02_00395831 predicted 1820
9 SASI_Rn02_00395832 predicted 1960
10 SASI_Rn02_00395833 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309087 predicted 500
2 SASI_Mm02_00309088 predicted 302
3 SASI_Mm02_00309089 predicted 285
4 SASI_Mm02_00309090 predicted 787
5 SASI_Mm02_00309091 predicted 296
6 SASI_Mm02_00309092 predicted 494
7 SASI_Mm02_00309093 predicted 347
8 SASI_Mm02_00309094 predicted 893
9 SASI_Mm02_00309095 predicted 342
10 SASI_Mm02_00309096 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007540
CDHR4 MISSION shRNA Bacterial Glycerol Stock
cadherin-related family member 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007540.1-323s1c1
Sequence:CCGGGCTGAAGTTCACATGTGGCAACTCGAGTTGCCACATGTGAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007540.1-326s1c1
Sequence:CCGGGAAGTTCACATGTGGCAACCACTCGAGTGGTTGCCACATGTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007540.1-251s1c1
Sequence:CCGGCTATGTGGGCAAGTTGACCTTCTCGAGAAGGTCAACTTGCCCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163333    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007540.1-711s1c1
Sequence:CCGGGATGAGCCTCTACATGATGTACTCGAGTACATCATGTAGAGGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007540.1-296s1c1
Sequence:CCGGCCTGATGGTGAACCACTACAACTCGAGTTGTAGTGGTTCACCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160177    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007540.1-718s1c1
Sequence:CCGGCTCTACATGATGTATGTTCTTCTCGAGAAGAACATACATCATGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007540
CDHR4 MISSION shRNA shRNA Plasmid DNA
cadherin-related family member 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007540.1-323s1c1
Sequence:CCGGGCTGAAGTTCACATGTGGCAACTCGAGTTGCCACATGTGAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007540.1-326s1c1
Sequence:CCGGGAAGTTCACATGTGGCAACCACTCGAGTGGTTGCCACATGTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007540.1-251s1c1
Sequence:CCGGCTATGTGGGCAAGTTGACCTTCTCGAGAAGGTCAACTTGCCCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163333    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007540.1-711s1c1
Sequence:CCGGGATGAGCCTCTACATGATGTACTCGAGTACATCATGTAGAGGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007540.1-296s1c1
Sequence:CCGGCCTGATGGTGAACCACTACAACTCGAGTTGTAGTGGTTCACCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160177    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007540.1-718s1c1
Sequence:CCGGCTCTACATGATGTATGTTCTTCTCGAGAAGAACATACATCATGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007540
CDHR4 MISSION shRNA Lentiviral Transduction Particles
cadherin-related family member 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007540.1-323s1c1
Sequence:CCGGGCTGAAGTTCACATGTGGCAACTCGAGTTGCCACATGTGAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007540.1-326s1c1
Sequence:CCGGGAAGTTCACATGTGGCAACCACTCGAGTGGTTGCCACATGTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007540.1-251s1c1
Sequence:CCGGCTATGTGGGCAAGTTGACCTTCTCGAGAAGGTCAACTTGCCCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163333    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007540.1-711s1c1
Sequence:CCGGGATGAGCCTCTACATGATGTACTCGAGTACATCATGTAGAGGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007540.1-296s1c1
Sequence:CCGGCCTGATGGTGAACCACTACAACTCGAGTTGTAGTGGTTCACCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160177    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007540.1-718s1c1
Sequence:CCGGCTCTACATGATGTATGTTCTTCTCGAGAAGAACATACATCATGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks