EMAIL THIS PAGE TO A FRIEND

CDHR5

cadherin-related family member 5

108 Gene Product Result for
Synonyms: MU-PCDH MUCDHL MUPCDH
Gene ID:
Human(53841) Summary: This gene is a novel mucin-like gene that is a member of the cadherin superfamily. While encoding nonpolymorphic tandem repeats rich in proline, serine and threonine similar to mucin proteins, the gene also contains sequence encoding calcium-binding motifs found in all cadherins. The role of the hybrid extracellular region and the specific function of this protein have not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jan 2010]
Mouse(72040) cadherin-related family member 5
Rat(171554) cadherin-related family member 5
domestic guinea pig(100733917) cadherin-related family member 5
naked mole-rat(101709968) cadherin-related family member 5
sheep(101103359) cadherin-related family member 5
chicken(770055) cadherin-related family member 5
cow(100125282) cadherin-related family member 5
domestic cat(101083802) cadherin-related family member 5
dog(607196) cadherin-related family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017717 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028069 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028069 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028069 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134871 MISSION® esiRNA esiRNA human MUCDHL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017717 Rosetta Predictions human pricing
NM_021924 Rosetta Predictions human pricing
NM_031264 Rosetta Predictions human pricing
NM_031265 Rosetta Predictions human pricing
NM_138525 Rosetta Predictions rat pricing
NM_001114322 Rosetta Predictions mouse pricing
NM_028069 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119618 predicted 1170
2 SASI_Hs01_00119619 predicted 837
3 SASI_Hs01_00119620 predicted 841
4 SASI_Hs01_00119621 predicted 833
5 SASI_Hs01_00119622 predicted 802
6 SASI_Hs01_00119623 predicted 979
7 SASI_Hs01_00119624 predicted 1207
8 SASI_Hs01_00119625 predicted 1308
9 SASI_Hs01_00119626 predicted 1138
10 SASI_Hs01_00119627 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355199 predicted 2616
2 SASI_Hs02_00355200 predicted 394
3 SASI_Hs01_00219552 predicted 941
4 SASI_Hs02_00355201 predicted 2618
5 SASI_Hs01_00219553 predicted 610
6 SASI_Hs01_00219555 predicted 618
7 SASI_Hs01_00219556 predicted 584
8 SASI_Hs02_00355202 predicted 408
9 SASI_Hs02_00355203 predicted 2923
10 SASI_Hs02_00355204 predicted 416
11 SASI_Hs01_00219554 predicted 841
12 SASI_Hs01_00219557 predicted 983
13 SASI_Hs01_00219558 predicted 1201
14 SASI_Hs01_00219559 predicted 1309
15 SASI_Hs01_00219560 predicted 1138
16 SASI_Hs01_00219561 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358670 predicted 2034
2 SASI_Hs02_00358671 predicted 387
3 SASI_Hs01_00097748 predicted 940
4 SASI_Hs02_00358672 predicted 2039
5 SASI_Hs01_00097749 predicted 617
6 SASI_Hs01_00097751 predicted 619
7 SASI_Hs01_00097752 predicted 577
8 SASI_Hs02_00358673 predicted 404
9 SASI_Hs02_00358674 predicted 2342
10 SASI_Hs02_00358675 predicted 420
11 SASI_Hs01_00097750 predicted 587
12 SASI_Hs01_00097753 predicted 734
13 SASI_Hs01_00097754 predicted 957
14 SASI_Hs01_00097755 predicted 1061
15 SASI_Hs01_00097756 predicted 893
16 SASI_Hs01_00097757 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054292 predicted 703
2 SASI_Hs01_00054293 predicted 696
3 SASI_Hs01_00054294 predicted 665
4 SASI_Hs01_00054295 predicted 842
5 SASI_Hs01_00054296 predicted 699
6 SASI_Hs01_00054297 predicted 706
7 SASI_Hs01_00054298 predicted 475
8 SASI_Hs01_00054299 predicted 522
9 SASI_Hs01_00054300 predicted 422
10 SASI_Hs01_00054301 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068011 predicted 887
2 SASI_Rn01_00068012 predicted 265
3 SASI_Rn01_00068013 predicted 1370
4 SASI_Rn01_00068014 predicted 677
5 SASI_Rn01_00068015 predicted 2394
6 SASI_Rn01_00068016 predicted 935
7 SASI_Rn01_00068017 predicted 1340
8 SASI_Rn01_00068019 predicted 876
9 SASI_Rn01_00068020 predicted 457
10 SASI_Rn02_00268145 predicted 275
11 SASI_Rn01_00068018 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308510 predicted 278
2 SASI_Mm02_00308511 predicted 905
3 SASI_Mm02_00308512 predicted 204
4 SASI_Mm02_00308513 predicted 273
5 SASI_Mm02_00308514 predicted 2335
6 SASI_Mm02_00308515 predicted 464
7 SASI_Mm02_00308516 predicted 925
8 SASI_Mm02_00308517 predicted 963
9 SASI_Mm02_00308518 predicted 920
10 SASI_Mm02_00308519 predicted 2382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333270 predicted 284
2 SASI_Mm01_00025152 predicted 906
3 SASI_Mm02_00333271 predicted 201
4 SASI_Mm01_00025154 predicted 273
5 SASI_Mm01_00025156 predicted 1845
6 SASI_Mm02_00333272 predicted 461
7 SASI_Mm02_00333273 predicted 928
8 SASI_Mm02_00333274 predicted 972
9 SASI_Mm02_00333275 predicted 915
10 SASI_Mm01_00025158 predicted 1888
11 SASI_Mm01_00025153 predicted 906
12 SASI_Mm01_00025155 predicted 1366
13 SASI_Mm01_00025157 predicted 1252
14 SASI_Mm01_00025159 predicted 1337
15 SASI_Mm01_00025160 predicted 883
16 SASI_Mm01_00025161 predicted 949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017717
CDHR5 MISSION shRNA Bacterial Glycerol Stock
cadherin-related family member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-1511s1c1
Sequence:CCGGCGGCCATCACATATCGAATTACTCGAGTAATTCGATATGTGATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-1059s1c1
Sequence:CCGGCGTCTGCATTCAAGCTCAGTACTCGAGTACTGAGCTTGAATGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-412s1c1
Sequence:CCGGTCTGTGAACAAGGACATCTTTCTCGAGAAAGATGTCCTTGTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-1206s1c1
Sequence:CCGGCGTGAATGGTACATTCATCATCTCGAGATGATGAATGTACCATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-694s1c1
Sequence:CCGGCCCTTTAAGACCAAGGAGATACTCGAGTATCTCCTTGGTCTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017717
CDHR5 MISSION shRNA shRNA Plasmid DNA
cadherin-related family member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-1511s1c1
Sequence:CCGGCGGCCATCACATATCGAATTACTCGAGTAATTCGATATGTGATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-1059s1c1
Sequence:CCGGCGTCTGCATTCAAGCTCAGTACTCGAGTACTGAGCTTGAATGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-412s1c1
Sequence:CCGGTCTGTGAACAAGGACATCTTTCTCGAGAAAGATGTCCTTGTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-1206s1c1
Sequence:CCGGCGTGAATGGTACATTCATCATCTCGAGATGATGAATGTACCATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-694s1c1
Sequence:CCGGCCCTTTAAGACCAAGGAGATACTCGAGTATCTCCTTGGTCTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017717
CDHR5 MISSION shRNA Lentiviral Transduction Particles
cadherin-related family member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-1511s1c1
Sequence:CCGGCGGCCATCACATATCGAATTACTCGAGTAATTCGATATGTGATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-1059s1c1
Sequence:CCGGCGTCTGCATTCAAGCTCAGTACTCGAGTACTGAGCTTGAATGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-412s1c1
Sequence:CCGGTCTGTGAACAAGGACATCTTTCTCGAGAAAGATGTCCTTGTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-1206s1c1
Sequence:CCGGCGTGAATGGTACATTCATCATCTCGAGATGATGAATGTACCATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017717.3-694s1c1
Sequence:CCGGCCCTTTAAGACCAAGGAGATACTCGAGTATCTCCTTGGTCTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028069
CDHR5 MISSION shRNA Bacterial Glycerol Stock
cadherin-related family member 5
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-919s1c1
Sequence:CCGGCAGTCTATCATCTACAGCATTCTCGAGAATGCTGTAGATGATAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-476s1c1
Sequence:CCGGCCAAAGTGAATACAACCGTCACTCGAGTGACGGTTGTATTCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-918s1c1
Sequence:CCGGCCAGTCTATCATCTACAGCATCTCGAGATGCTGTAGATGATAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-1839s1c1
Sequence:CCGGCGTGAGGTCTATCCTGACTAACTCGAGTTAGTCAGGATAGACCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-517s1c1
Sequence:CCGGGCTACAGATGCTGACATAAATCTCGAGATTTATGTCAGCATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028069.3-1366s21c1
Sequence:CCGGTAGAGGTAGAAGCTAGCAATACTCGAGTATTGCTAGCTTCTACCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028069
CDHR5 MISSION shRNA shRNA Plasmid DNA
cadherin-related family member 5
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-919s1c1
Sequence:CCGGCAGTCTATCATCTACAGCATTCTCGAGAATGCTGTAGATGATAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-476s1c1
Sequence:CCGGCCAAAGTGAATACAACCGTCACTCGAGTGACGGTTGTATTCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-918s1c1
Sequence:CCGGCCAGTCTATCATCTACAGCATCTCGAGATGCTGTAGATGATAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-1839s1c1
Sequence:CCGGCGTGAGGTCTATCCTGACTAACTCGAGTTAGTCAGGATAGACCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-517s1c1
Sequence:CCGGGCTACAGATGCTGACATAAATCTCGAGATTTATGTCAGCATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028069.3-1366s21c1
Sequence:CCGGTAGAGGTAGAAGCTAGCAATACTCGAGTATTGCTAGCTTCTACCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028069
CDHR5 MISSION shRNA Lentiviral Transduction Particles
cadherin-related family member 5
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-919s1c1
Sequence:CCGGCAGTCTATCATCTACAGCATTCTCGAGAATGCTGTAGATGATAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-476s1c1
Sequence:CCGGCCAAAGTGAATACAACCGTCACTCGAGTGACGGTTGTATTCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-918s1c1
Sequence:CCGGCCAGTCTATCATCTACAGCATCTCGAGATGCTGTAGATGATAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-1839s1c1
Sequence:CCGGCGTGAGGTCTATCCTGACTAACTCGAGTTAGTCAGGATAGACCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028069.1-517s1c1
Sequence:CCGGGCTACAGATGCTGACATAAATCTCGAGATTTATGTCAGCATCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028069.3-1366s21c1
Sequence:CCGGTAGAGGTAGAAGCTAGCAATACTCGAGTATTGCTAGCTTCTACCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks