EMAIL THIS PAGE TO A FRIEND

CDIP1

cell death-inducing p53 target 1

78 Gene Product Result for
Synonyms: C16orf5 CDIP I1 LITAFL
Gene ID:
Mouse(66626) cell death inducing Trp53 target 1
Rat(360480) cell death-inducing p53 target 1
naked mole-rat(101721224) cell death-inducing p53 target 1
domestic guinea pig(100720191) cell death-inducing p53 target 1
sheep(101102693) cell death-inducing p53 target 1
cow(510242) chromosome 25 open reading frame, human C16orf5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013399 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013399 Rosetta Predictions human pricing
NM_001008360 Rosetta Predictions rat pricing
NM_025670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344769 predicted 1256
2 SASI_Hs02_00344770 predicted 820
3 SASI_Hs02_00344771 predicted 437
4 SASI_Hs01_00071996 predicted 1067
5 SASI_Hs02_00344772 predicted 1268
6 SASI_Hs02_00344773 predicted 1023
7 SASI_Hs02_00344774 predicted 1210
8 SASI_Hs02_00344775 predicted 1060
9 SASI_Hs02_00344776 predicted 806
10 SASI_Hs02_00344777 predicted 1310
11 SASI_Hs01_00071993 predicted 1493
12 SASI_Hs01_00071994 predicted 541
13 SASI_Hs01_00071995 predicted 1180
14 SASI_Hs01_00071997 predicted 1586
15 SASI_Hs01_00071998 predicted 1581
16 SASI_Hs01_00071999 predicted 1506
17 SASI_Hs01_00072000 predicted 1407
18 SASI_Hs01_00072001 predicted 1147
19 SASI_Hs01_00072002 predicted 1582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040755 predicted 851
2 SASI_Rn01_00040756 predicted 1128
3 SASI_Rn01_00040757 predicted 1113
4 SASI_Rn01_00040760 predicted 1300
5 SASI_Rn01_00040761 predicted 966
6 SASI_Rn01_00040763 predicted 1117
7 SASI_Rn01_00040764 predicted 723
8 SASI_Rn02_00199125 predicted 1110
9 SASI_Rn02_00199126 predicted 1109
10 SASI_Rn02_00199127 predicted 678
11 SASI_Rn01_00040758 predicted 701
12 SASI_Rn01_00040759 predicted 1177
13 SASI_Rn01_00040762 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144689 predicted 800
2 SASI_Mm01_00144690 predicted 1070
3 SASI_Mm01_00144691 predicted 1094
4 SASI_Mm01_00144692 predicted 943
5 SASI_Mm01_00144693 predicted 1045
6 SASI_Mm01_00144694 predicted 1291
7 SASI_Mm01_00144695 predicted 417
8 SASI_Mm01_00144696 predicted 987
9 SASI_Mm01_00144697 predicted 1266
10 SASI_Mm01_00144698 predicted 209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013399
CDIP1 MISSION shRNA Bacterial Glycerol Stock
cell death-inducing p53 target 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013399.2-598s21c1
Sequence:CCGGTGCTGCAGGGAGAGATCTTTGCTCGAGCAAAGATCTCTCCCTGCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013399.2-812s21c1
Sequence:CCGGAGCCTACATCTACACGTACAACTCGAGTTGTACGTGTAGATGTAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013399.2-1174s21c1
Sequence:CCGGAGGTTCAGTCCAGACTCTTTCCTCGAGGAAAGAGTCTGGACTGAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013399.2-1311s21c1
Sequence:CCGGCACGTAGGACAGGGTCACAAACTCGAGTTTGTGACCCTGTCCTACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013399.2-720s21c1
Sequence:CCGGTGTTGCTTCATGGGATGTGATCTCGAGATCACATCCCATGAAGCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013399.1-2001s1c1
Sequence:CCGGGCCCTGTCTTTATTTCCTGAACTCGAGTTCAGGAAATAAAGACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013399.1-887s1c1
Sequence:CCGGGCAAAGCTACATCTACACGTACTCGAGTACGTGTAGATGTAGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013399.1-759s1c1
Sequence:CCGGCTACGAGATTGGCTTGATGAACTCGAGTTCATCAAGCCAATCTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013399.1-499s1c1
Sequence:CCGGCCACCACACATGAGTGCAGATCTCGAGATCTGCACTCATGTGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013399
CDIP1 MISSION shRNA shRNA Plasmid DNA
cell death-inducing p53 target 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013399.2-598s21c1
Sequence:CCGGTGCTGCAGGGAGAGATCTTTGCTCGAGCAAAGATCTCTCCCTGCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013399.2-812s21c1
Sequence:CCGGAGCCTACATCTACACGTACAACTCGAGTTGTACGTGTAGATGTAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013399.2-1174s21c1
Sequence:CCGGAGGTTCAGTCCAGACTCTTTCCTCGAGGAAAGAGTCTGGACTGAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013399.2-1311s21c1
Sequence:CCGGCACGTAGGACAGGGTCACAAACTCGAGTTTGTGACCCTGTCCTACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013399.2-720s21c1
Sequence:CCGGTGTTGCTTCATGGGATGTGATCTCGAGATCACATCCCATGAAGCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013399.1-2001s1c1
Sequence:CCGGGCCCTGTCTTTATTTCCTGAACTCGAGTTCAGGAAATAAAGACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013399.1-887s1c1
Sequence:CCGGGCAAAGCTACATCTACACGTACTCGAGTACGTGTAGATGTAGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013399.1-759s1c1
Sequence:CCGGCTACGAGATTGGCTTGATGAACTCGAGTTCATCAAGCCAATCTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013399.1-499s1c1
Sequence:CCGGCCACCACACATGAGTGCAGATCTCGAGATCTGCACTCATGTGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013399
CDIP1 MISSION shRNA Lentiviral Transduction Particles
cell death-inducing p53 target 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013399.2-598s21c1
Sequence:CCGGTGCTGCAGGGAGAGATCTTTGCTCGAGCAAAGATCTCTCCCTGCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013399.2-812s21c1
Sequence:CCGGAGCCTACATCTACACGTACAACTCGAGTTGTACGTGTAGATGTAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013399.2-1174s21c1
Sequence:CCGGAGGTTCAGTCCAGACTCTTTCCTCGAGGAAAGAGTCTGGACTGAACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013399.2-1311s21c1
Sequence:CCGGCACGTAGGACAGGGTCACAAACTCGAGTTTGTGACCCTGTCCTACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013399.2-720s21c1
Sequence:CCGGTGTTGCTTCATGGGATGTGATCTCGAGATCACATCCCATGAAGCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013399.1-2001s1c1
Sequence:CCGGGCCCTGTCTTTATTTCCTGAACTCGAGTTCAGGAAATAAAGACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013399.1-887s1c1
Sequence:CCGGGCAAAGCTACATCTACACGTACTCGAGTACGTGTAGATGTAGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013399.1-759s1c1
Sequence:CCGGCTACGAGATTGGCTTGATGAACTCGAGTTCATCAAGCCAATCTCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013399.1-499s1c1
Sequence:CCGGCCACCACACATGAGTGCAGATCTCGAGATCTGCACTCATGTGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025670
VALIDATED
CDIP1 MISSION shRNA Bacterial Glycerol Stock
cell death-inducing p53 target 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025670.4-1834s21c1
Sequence:CCGGGAGTCGTGCCCAGGGTATAAACTCGAGTTTATACCCTGGGCACGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025670.4-713s21c1
Sequence:CCGGTGACCTGGGCTGCTGTTTGATCTCGAGATCAAACAGCAGCCCAGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025670.4-634s21c1
Sequence:CCGGAGGCCATCACCACCAAGATCTCTCGAGAGATCTTGGTGGTGATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025670.4-574s21c1
Sequence:CCGGTACTGCAGGGAGAGATCTTTGCTCGAGCAAAGATCTCTCCCTGCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025670.4-407s21c1
Sequence:CCGGGAATGCAGATGGCACCTACATCTCGAGATGTAGGTGCCATCTGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025670.2-1981s1c1
Sequence:CCGGCGCAGTTTGTAGTTTCATTAACTCGAGTTAATGAAACTACAAACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025670.2-787s1c1
Sequence:CCGGCAAAGCCTACATCTGCACATACTCGAGTATGTGCAGATGTAGGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025670.2-531s1c1
Sequence:CCGGCGGCCACAGTATTGGTCCCATCTCGAGATGGGACCAATACTGTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025670.2-673s1c1
Sequence:CCGGGATGAACTTTGTGCTGGGTTTCTCGAGAAACCCAGCACAAAGTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025670.2-461s1c1
Sequence:CCGGCACCCACCTATGGGCTATTATCTCGAGATAATAGCCCATAGGTGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025670
VALIDATED
CDIP1 MISSION shRNA shRNA Plasmid DNA
cell death-inducing p53 target 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025670.4-1834s21c1
Sequence:CCGGGAGTCGTGCCCAGGGTATAAACTCGAGTTTATACCCTGGGCACGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025670.4-713s21c1
Sequence:CCGGTGACCTGGGCTGCTGTTTGATCTCGAGATCAAACAGCAGCCCAGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025670.4-634s21c1
Sequence:CCGGAGGCCATCACCACCAAGATCTCTCGAGAGATCTTGGTGGTGATGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025670.4-574s21c1
Sequence:CCGGTACTGCAGGGAGAGATCTTTGCTCGAGCAAAGATCTCTCCCTGCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025670.4-407s21c1
Sequence:CCGGGAATGCAGATGGCACCTACATCTCGAGATGTAGGTGCCATCTGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025670.2-1981s1c1
Sequence:CCGGCGCAGTTTGTAGTTTCATTAACTCGAGTTAATGAAACTACAAACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025670.2-787s1c1
Sequence:CCGGCAAAGCCTACATCTGCACATACTCGAGTATGTGCAGATGTAGGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025670.2-531s1c1
Sequence:CCGGCGGCCACAGTATTGGTCCCATCTCGAGATGGGACCAATACTGTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025670.2-673s1c1
Sequence:CCGGGATGAACTTTGTGCTGGGTTTCTCGAGAAACCCAGCACAAAGTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025670.2-461s1c1
Sequence:CCGGCACCCACCTATGGGCTATTATCTCGAGATAATAGCCCATAGGTGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025670
VALIDATED
CDIP1 MISSION shRNA Lentiviral Transduction Particles
cell death-inducing p53 target 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025670.4-1834s21c1
Sequence:CCGGGAGTCGTGCCCAGGGTATAAACTCGAGTTTATACCCTGGGCACGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025670.4-713s21c1
Sequence:CCGGTGACCTGGGCTGCTGTTTGATCTCGAGATCAAACAGCAGCCCAGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025670.4-634s21c1
Sequence:CCGGAGGCCATCACCACCAAGATCTCTCGAGAGATCTTGGTGGTGATGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025670.4-574s21c1
Sequence:CCGGTACTGCAGGGAGAGATCTTTGCTCGAGCAAAGATCTCTCCCTGCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025670.4-407s21c1
Sequence:CCGGGAATGCAGATGGCACCTACATCTCGAGATGTAGGTGCCATCTGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025670.2-1981s1c1
Sequence:CCGGCGCAGTTTGTAGTTTCATTAACTCGAGTTAATGAAACTACAAACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025670.2-787s1c1
Sequence:CCGGCAAAGCCTACATCTGCACATACTCGAGTATGTGCAGATGTAGGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025670.2-531s1c1
Sequence:CCGGCGGCCACAGTATTGGTCCCATCTCGAGATGGGACCAATACTGTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025670.2-673s1c1
Sequence:CCGGGATGAACTTTGTGCTGGGTTTCTCGAGAAACCCAGCACAAAGTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025670.2-461s1c1
Sequence:CCGGCACCCACCTATGGGCTATTATCTCGAGATAATAGCCCATAGGTGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)