EMAIL THIS PAGE TO A FRIEND

CDIPT

CDP-diacylglycerol--inositol 3-phosphatidyltransferase

84 Gene Product Result for
Synonyms: PIS PIS1
UniProtKB ID: O14735, Q6FGU1, Q6ZN70
Gene ID:
Human(10423) Summary: Phosphatidylinositol breakdown products are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. Two enzymes, CDP-diacylglycerol synthase and phosphatidylinositol synthase, are involved in the biosynthesis of phosphatidylinositol. Phosphatidylinositol synthase, a member of the CDP-alcohol phosphatidyl transferase class-I family, is an integral membrane protein found on the cytoplasmic side of the endoplasmic reticulum and the Golgi apparatus. [provided by RefSeq, Jul 2008]
Mouse(52858) CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)
Rat(192260) CDP-diacylglycerol--inositol 3-phosphatidyltransferase
Zebrafish(404620) CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)
cow(515135) CDP-diacylglycerol--inositol 3-phosphatidyltransferase
domestic cat(101097119) CDP-diacylglycerol--inositol 3-phosphatidyltransferase
dog(489940) CDP-diacylglycerol--inositol 3-phosphatidyltransferase
Goat(100861029) CDP-diacylglycerol--inositol 3-phosphatidyltransferase
sheep(101119178) CDP-diacylglycerol--inositol 3-phosphatidyltransferase
domestic guinea pig(100734579) CDP-diacylglycerol--inositol 3-phosphatidyltransferase
naked mole-rat(101714318) CDP-diacylglycerol--inositol 3-phosphatidyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138754 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138754 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138754 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006319 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU008831 MISSION® esiRNA esiRNA targeting mouse Cdipt (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006319 Rosetta Predictions human pricing
NM_145752 Rosetta Predictions human pricing
NM_138899 Rosetta Predictions rat pricing
NM_026638 Rosetta Predictions mouse pricing
NM_138754 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149394 predicted 1288
2 SASI_Hs02_00341341 predicted 450
3 SASI_Hs01_00149396 predicted 872
4 SASI_Hs01_00149397 predicted 835
5 SASI_Hs02_00341342 predicted 459
6 SASI_Hs01_00149398 predicted 787
7 SASI_Hs01_00149399 predicted 1009
8 SASI_Hs01_00149400 predicted 740
9 SASI_Hs01_00149401 predicted 1217
10 SASI_Hs01_00149402 predicted 854
11 SASI_Hs01_00149395 predicted 797
12 SASI_Hs01_00149403 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234315 predicted 1325
2 SASI_Hs01_00234316 predicted 888
3 SASI_Hs01_00234317 predicted 899
4 SASI_Hs01_00234318 predicted 860
5 SASI_Hs01_00234319 predicted 809
6 SASI_Hs01_00234320 predicted 1039
7 SASI_Hs01_00234321 predicted 774
8 SASI_Hs01_00234322 predicted 1247
9 SASI_Hs01_00234323 predicted 894
10 SASI_Hs01_00234324 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058530 predicted 455
2 SASI_Rn01_00058531 predicted 778
3 SASI_Rn02_00268354 predicted 612
4 SASI_Rn01_00058532 predicted 662
5 SASI_Rn01_00058533 predicted 411
6 SASI_Rn01_00058534 predicted 704
7 SASI_Rn01_00058536 predicted 1308
8 SASI_Rn01_00058537 predicted 532
9 SASI_Rn01_00058539 predicted 412
10 SASI_Rn02_00268355 predicted 605
11 SASI_Rn01_00058535 predicted 921
12 SASI_Rn01_00058538 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136803 predicted 1498
2 SASI_Mm01_00136804 predicted 640
3 SASI_Mm01_00136805 predicted 764
4 SASI_Mm02_00330625 predicted 1203
5 SASI_Mm01_00136806 predicted 551
6 SASI_Mm01_00136807 predicted 1393
7 SASI_Mm01_00136808 predicted 705
8 SASI_Mm01_00136809 predicted 798
9 SASI_Mm01_00136810 predicted 440
10 SASI_Mm01_00136812 predicted 546
11 SASI_Mm01_00136811 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034259 predicted 1458
2 SASI_Mm01_00034260 predicted 602
3 SASI_Mm01_00034261 predicted 728
4 SASI_Mm02_00339806 predicted 1163
5 SASI_Mm01_00034262 predicted 512
6 SASI_Mm01_00034263 predicted 1353
7 SASI_Mm01_00034264 predicted 665
8 SASI_Mm01_00034265 predicted 760
9 SASI_Mm01_00034266 predicted 398
10 SASI_Mm01_00034268 predicted 503
11 SASI_Mm01_00034267 predicted 846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138754
VALIDATED
CDIPT MISSION shRNA Bacterial Glycerol Stock
CDP-diacylglycerol--inositol 3-phosphatidyltransferase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138754.1-1462s1c1
Sequence:CCGGGCTCTGGAAACCTCCACAATACTCGAGTATTGTGGAGGTTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138754.1-763s1c1
Sequence:CCGGCCTGTGCTTCGGATCTACTATCTCGAGATAGTAGATCCGAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138754.1-835s1c1
Sequence:CCGGTGCCTCCTGTATCTCTTCAATCTCGAGATTGAAGAGATACAGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138754.1-405s1c1
Sequence:CCGGCGTGCCTAACCTTATCGGTTACTCGAGTAACCGATAAGGTTAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138754.1-546s1c1
Sequence:CCGGCCTTAATCAAGGAACCCGGTTCTCGAGAACCGGGTTCCTTGATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138754.3-761s21c1
Sequence:CCGGCCTGTGCTTCGGATCTACTATCTCGAGATAGTAGATCCGAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138754.3-1460s21c1
Sequence:CCGGGCTCTGGAAACCTCCACAATACTCGAGTATTGTGGAGGTTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138754.3-403s21c1
Sequence:CCGGCGTGCCTAACCTTATCGGTTACTCGAGTAACCGATAAGGTTAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138754.3-833s21c1
Sequence:CCGGTGCCTCCTGTATCTCTTCAATCTCGAGATTGAAGAGATACAGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138754
VALIDATED
CDIPT MISSION shRNA shRNA Plasmid DNA
CDP-diacylglycerol--inositol 3-phosphatidyltransferase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138754.1-1462s1c1
Sequence:CCGGGCTCTGGAAACCTCCACAATACTCGAGTATTGTGGAGGTTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138754.1-763s1c1
Sequence:CCGGCCTGTGCTTCGGATCTACTATCTCGAGATAGTAGATCCGAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138754.1-835s1c1
Sequence:CCGGTGCCTCCTGTATCTCTTCAATCTCGAGATTGAAGAGATACAGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138754.1-405s1c1
Sequence:CCGGCGTGCCTAACCTTATCGGTTACTCGAGTAACCGATAAGGTTAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138754.1-546s1c1
Sequence:CCGGCCTTAATCAAGGAACCCGGTTCTCGAGAACCGGGTTCCTTGATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138754.3-761s21c1
Sequence:CCGGCCTGTGCTTCGGATCTACTATCTCGAGATAGTAGATCCGAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138754.3-1460s21c1
Sequence:CCGGGCTCTGGAAACCTCCACAATACTCGAGTATTGTGGAGGTTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138754.3-403s21c1
Sequence:CCGGCGTGCCTAACCTTATCGGTTACTCGAGTAACCGATAAGGTTAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138754.3-833s21c1
Sequence:CCGGTGCCTCCTGTATCTCTTCAATCTCGAGATTGAAGAGATACAGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138754
VALIDATED
CDIPT MISSION shRNA Lentiviral Transduction Particles
CDP-diacylglycerol--inositol 3-phosphatidyltransferase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138754.1-1462s1c1
Sequence:CCGGGCTCTGGAAACCTCCACAATACTCGAGTATTGTGGAGGTTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138754.1-763s1c1
Sequence:CCGGCCTGTGCTTCGGATCTACTATCTCGAGATAGTAGATCCGAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138754.1-835s1c1
Sequence:CCGGTGCCTCCTGTATCTCTTCAATCTCGAGATTGAAGAGATACAGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138754.1-405s1c1
Sequence:CCGGCGTGCCTAACCTTATCGGTTACTCGAGTAACCGATAAGGTTAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138754.1-546s1c1
Sequence:CCGGCCTTAATCAAGGAACCCGGTTCTCGAGAACCGGGTTCCTTGATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138754.3-761s21c1
Sequence:CCGGCCTGTGCTTCGGATCTACTATCTCGAGATAGTAGATCCGAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138754.3-1460s21c1
Sequence:CCGGGCTCTGGAAACCTCCACAATACTCGAGTATTGTGGAGGTTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138754.3-403s21c1
Sequence:CCGGCGTGCCTAACCTTATCGGTTACTCGAGTAACCGATAAGGTTAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138754.3-833s21c1
Sequence:CCGGTGCCTCCTGTATCTCTTCAATCTCGAGATTGAAGAGATACAGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006319
VALIDATED
CDIPT MISSION shRNA Bacterial Glycerol Stock
CDP-diacylglycerol--inositol 3-phosphatidyltransferase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-687s1c1
Sequence:CCGGGAGTCACAAGATGATCGACTTCTCGAGAAGTCGATCATCTTGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-396s1c1
Sequence:CCGGCGCCATCATTTCTTTCTACTTCTCGAGAAGTAGAAAGAAATGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-385s1c1
Sequence:CCGGCGGATTGTCTTCGCCATCATTCTCGAGAATGATGGCGAAGACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-612s1c1
Sequence:CCGGCTTCCAAATCAGCATGAGTTTCTCGAGAAACTCATGCTGATTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-494s1c1
Sequence:CCGGCTCGCGCTCTTAATCAAGGAACTCGAGTTCCTTGATTAAGAGCGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006319.3-754s21c1
Sequence:CCGGGAGTCACAAGATGATCGACTTCTCGAGAAGTCGATCATCTTGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006319.3-463s21c1
Sequence:CCGGCGCCATCATTTCTTTCTACTTCTCGAGAAGTAGAAAGAAATGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006319.3-561s21c1
Sequence:CCGGCTCGCGCTCTTAATCAAGGAACTCGAGTTCCTTGATTAAGAGCGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006319.3-452s21c1
Sequence:CCGGCGGATTGTCTTCGCCATCATTCTCGAGAATGATGGCGAAGACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006319
VALIDATED
CDIPT MISSION shRNA shRNA Plasmid DNA
CDP-diacylglycerol--inositol 3-phosphatidyltransferase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-687s1c1
Sequence:CCGGGAGTCACAAGATGATCGACTTCTCGAGAAGTCGATCATCTTGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-396s1c1
Sequence:CCGGCGCCATCATTTCTTTCTACTTCTCGAGAAGTAGAAAGAAATGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-385s1c1
Sequence:CCGGCGGATTGTCTTCGCCATCATTCTCGAGAATGATGGCGAAGACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-612s1c1
Sequence:CCGGCTTCCAAATCAGCATGAGTTTCTCGAGAAACTCATGCTGATTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-494s1c1
Sequence:CCGGCTCGCGCTCTTAATCAAGGAACTCGAGTTCCTTGATTAAGAGCGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006319.3-754s21c1
Sequence:CCGGGAGTCACAAGATGATCGACTTCTCGAGAAGTCGATCATCTTGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006319.3-463s21c1
Sequence:CCGGCGCCATCATTTCTTTCTACTTCTCGAGAAGTAGAAAGAAATGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006319.3-561s21c1
Sequence:CCGGCTCGCGCTCTTAATCAAGGAACTCGAGTTCCTTGATTAAGAGCGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006319.3-452s21c1
Sequence:CCGGCGGATTGTCTTCGCCATCATTCTCGAGAATGATGGCGAAGACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006319
VALIDATED
CDIPT MISSION shRNA Lentiviral Transduction Particles
CDP-diacylglycerol--inositol 3-phosphatidyltransferase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-687s1c1
Sequence:CCGGGAGTCACAAGATGATCGACTTCTCGAGAAGTCGATCATCTTGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-396s1c1
Sequence:CCGGCGCCATCATTTCTTTCTACTTCTCGAGAAGTAGAAAGAAATGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-385s1c1
Sequence:CCGGCGGATTGTCTTCGCCATCATTCTCGAGAATGATGGCGAAGACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-612s1c1
Sequence:CCGGCTTCCAAATCAGCATGAGTTTCTCGAGAAACTCATGCTGATTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006319.2-494s1c1
Sequence:CCGGCTCGCGCTCTTAATCAAGGAACTCGAGTTCCTTGATTAAGAGCGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006319.3-754s21c1
Sequence:CCGGGAGTCACAAGATGATCGACTTCTCGAGAAGTCGATCATCTTGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006319.3-463s21c1
Sequence:CCGGCGCCATCATTTCTTTCTACTTCTCGAGAAGTAGAAAGAAATGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006319.3-561s21c1
Sequence:CCGGCTCGCGCTCTTAATCAAGGAACTCGAGTTCCTTGATTAAGAGCGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006319.3-452s21c1
Sequence:CCGGCGGATTGTCTTCGCCATCATTCTCGAGAATGATGGCGAAGACAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks