EMAIL THIS PAGE TO A FRIEND

CDK10

cyclin-dependent kinase 10

183 Gene Product Result for
Synonyms: PISSLRE
Gene ID:
Human(8558) Summary: The protein encoded by this gene belongs to the CDK subfamily of the Ser/Thr protein kinase family. The CDK subfamily members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. This kinase has been shown to play a role in cellular proliferation and its function is limited to cell cycle G2-M phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Mouse(234854) cyclin-dependent kinase 10
Rat(361434) cyclin-dependent kinase 10
sheep(101107722) cyclin-dependent kinase 10
domestic guinea pig(100728180) cyclin-dependent kinase 10
naked mole-rat(101701217) cyclin-dependent kinase 10
Zebrafish(550285) cyclin-dependent kinase 10
chicken(415840) cyclin-dependent kinase 10
dog(489655) cyclin-dependent kinase 10
domestic cat(101080500) cyclin-dependent kinase 10
cow(615171) cyclin-dependent kinase 10
cow(785111) cell division protein kinase 10-like
Horse(100052321) cyclin-dependent kinase 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003674 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_052987 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052987 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052987 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_194444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094051 MISSION® esiRNA esiRNA human CDK10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098533 Rosetta Predictions human pricing
NM_003674 Rosetta Predictions human pricing
NM_052987 Rosetta Predictions human pricing
NM_052988 Rosetta Predictions human pricing
NM_001025722 Rosetta Predictions rat pricing
NM_001109936 Rosetta Predictions rat pricing
NM_001109937 Rosetta Predictions rat pricing
NM_194444 Rosetta Predictions mouse pricing
NM_194446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319370 predicted 348
2 SASI_Hs02_00319371 predicted 593
3 SASI_Hs02_00319372 predicted 329
4 SASI_Hs02_00319373 predicted 494
5 SASI_Hs02_00319374 predicted 559
6 SASI_Hs02_00319375 predicted 508
7 SASI_Hs02_00319376 predicted 495
8 SASI_Hs02_00319377 predicted 1443
9 SASI_Hs02_00319378 predicted 1322
10 SASI_Hs02_00319379 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061681 predicted 1503
2 SASI_Hs01_00061682 predicted 1651
3 SASI_Hs01_00061683 predicted 1610
4 SASI_Hs01_00061684 predicted 1614
5 SASI_Hs01_00061685 predicted 1494
6 SASI_Hs01_00061686 predicted 1506
7 SASI_Hs01_00061687 predicted 907
8 SASI_Hs01_00061688 predicted 1513
9 SASI_Hs01_00061689 predicted 1468
10 SASI_Hs01_00061690 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361792 predicted 348
2 SASI_Hs02_00361793 predicted 600
3 SASI_Hs02_00361794 predicted 328
4 SASI_Hs02_00361795 predicted 498
5 SASI_Hs02_00361796 predicted 552
6 SASI_Hs02_00361797 predicted 515
7 SASI_Hs02_00361798 predicted 491
8 SASI_Hs01_00233473 predicted 1332
9 SASI_Hs01_00233475 predicted 1215
10 SASI_Hs02_00361799 predicted 505
11 SASI_Hs01_00233471 predicted 1219
12 SASI_Hs01_00233472 predicted 1366
13 SASI_Hs01_00233474 predicted 1330
14 SASI_Hs01_00233476 predicted 1224
15 SASI_Hs01_00233477 predicted 763
16 SASI_Hs01_00233478 predicted 1232
17 SASI_Hs01_00233479 predicted 1186
18 SASI_Hs01_00233480 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361800 predicted 384
2 SASI_Hs02_00361801 predicted 636
3 SASI_Hs01_00163615 predicted 370
4 SASI_Hs01_00163618 predicted 534
5 SASI_Hs01_00163620 predicted 592
6 SASI_Hs01_00163619 predicted 552
7 SASI_Hs01_00163621 predicted 531
8 SASI_Hs02_00361802 predicted 1500
9 SASI_Hs02_00361803 predicted 1380
10 SASI_Hs02_00361804 predicted 550
11 SASI_Hs01_00163614 predicted 803
12 SASI_Hs01_00163616 predicted 569
13 SASI_Hs01_00163617 predicted 987
14 SASI_Hs01_00163622 predicted 598
15 SASI_Hs01_00163623 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060722 predicted 1232
2 SASI_Rn01_00060723 predicted 1034
3 SASI_Rn02_00203346 predicted 786
4 SASI_Rn01_00060726 predicted 966
5 SASI_Rn02_00203347 predicted 795
6 SASI_Rn02_00203348 predicted 1203
7 SASI_Rn02_00203349 predicted 893
8 SASI_Rn02_00203350 predicted 1294
9 SASI_Rn01_00060728 predicted 1102
10 SASI_Rn02_00203351 predicted 778
11 SASI_Rn01_00060724 predicted 628
12 SASI_Rn01_00060725 predicted 1352
13 SASI_Rn01_00060727 predicted 1319
14 SASI_Rn01_00060729 predicted 587
15 SASI_Rn01_00060730 predicted 551
16 SASI_Rn01_00060731 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250902 predicted 785
2 SASI_Rn02_00250903 predicted 580
3 SASI_Rn02_00250904 predicted 333
4 SASI_Rn02_00250905 predicted 515
5 SASI_Rn02_00250906 predicted 351
6 SASI_Rn02_00250907 predicted 748
7 SASI_Rn02_00250908 predicted 439
8 SASI_Rn02_00250909 predicted 845
9 SASI_Rn02_00250910 predicted 649
10 SASI_Rn02_00250911 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250912 predicted 737
2 SASI_Rn02_00250913 predicted 547
3 SASI_Rn02_00250914 predicted 290
4 SASI_Rn02_00250915 predicted 482
5 SASI_Rn02_00250916 predicted 310
6 SASI_Rn02_00250917 predicted 712
7 SASI_Rn02_00250918 predicted 401
8 SASI_Rn02_00250919 predicted 804
9 SASI_Rn02_00250920 predicted 614
10 SASI_Rn02_00250921 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169201 predicted 577
2 SASI_Mm01_00169202 predicted 332
3 SASI_Mm01_00169203 predicted 1173
4 SASI_Mm01_00169204 predicted 779
5 SASI_Mm01_00169205 predicted 340
6 SASI_Mm01_00169206 predicted 1321
7 SASI_Mm01_00169207 predicted 639
8 SASI_Mm01_00169208 predicted 861
9 SASI_Mm01_00169209 predicted 1380
10 SASI_Mm01_00169210 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066428 predicted 616
2 SASI_Mm01_00066429 predicted 368
3 SASI_Mm01_00066430 predicted 1208
4 SASI_Mm01_00066431 predicted 815
5 SASI_Mm01_00066432 predicted 379
6 SASI_Mm01_00066433 predicted 1364
7 SASI_Mm01_00066434 predicted 682
8 SASI_Mm01_00066435 predicted 897
9 SASI_Mm01_00066436 predicted 1415
10 SASI_Mm01_00066437 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003674
VALIDATED
CDK10 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.2-389s1c1
Sequence:CCGGCATCAGCAGCTTGCGGGAGATCTCGAGATCTCCCGCAAGCTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.2-1275s1c1
Sequence:CCGGCGATCAGTGGTGTCTGTGAAGCTCGAGCTTCACAGACACCACTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003674.2-1207s1c1
Sequence:CCGGGCCAGAGCAAGCGCTGTAAACCTCGAGGTTTACAGCGCTTGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.2-1496s1c1
Sequence:CCGGCATGTGGTCCTCCTCGCTATGCTCGAGCATAGCGAGGAGGACCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.2-916s1c1
Sequence:CCGGGCACGCCCAGTGAGAACATCTCTCGAGAGATGTTCTCACTGGGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003674.x-1571s1c1
Sequence:CCGGCTGTCTTTGAGTTGTGGTGGACTCGAGTCCACCACAACTCAAAGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.x-1046s1c1
Sequence:CCGGGCTGCACTTCCTGTTCATGTACTCGAGTACATGAACAGGAAGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003674.x-332s1c1
Sequence:CCGGAGATGAGATTGTCGCACTGAACTCGAGTTCAGTGCGACAATCTCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003674.x-1055s1c1
Sequence:CCGGCCTGTTCATGTACGACCCTAACTCGAGTTAGGGTCGTACATGAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.x-992s1c1
Sequence:CCGGCTACAACAACCTGAAGCACAACTCGAGTTGTGCTTCAGGTTGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003674
VALIDATED
CDK10 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.2-389s1c1
Sequence:CCGGCATCAGCAGCTTGCGGGAGATCTCGAGATCTCCCGCAAGCTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.2-1275s1c1
Sequence:CCGGCGATCAGTGGTGTCTGTGAAGCTCGAGCTTCACAGACACCACTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003674.2-1207s1c1
Sequence:CCGGGCCAGAGCAAGCGCTGTAAACCTCGAGGTTTACAGCGCTTGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.2-1496s1c1
Sequence:CCGGCATGTGGTCCTCCTCGCTATGCTCGAGCATAGCGAGGAGGACCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.2-916s1c1
Sequence:CCGGGCACGCCCAGTGAGAACATCTCTCGAGAGATGTTCTCACTGGGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003674.x-1571s1c1
Sequence:CCGGCTGTCTTTGAGTTGTGGTGGACTCGAGTCCACCACAACTCAAAGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.x-1046s1c1
Sequence:CCGGGCTGCACTTCCTGTTCATGTACTCGAGTACATGAACAGGAAGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003674.x-332s1c1
Sequence:CCGGAGATGAGATTGTCGCACTGAACTCGAGTTCAGTGCGACAATCTCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003674.x-1055s1c1
Sequence:CCGGCCTGTTCATGTACGACCCTAACTCGAGTTAGGGTCGTACATGAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.x-992s1c1
Sequence:CCGGCTACAACAACCTGAAGCACAACTCGAGTTGTGCTTCAGGTTGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003674
VALIDATED
CDK10 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.2-389s1c1
Sequence:CCGGCATCAGCAGCTTGCGGGAGATCTCGAGATCTCCCGCAAGCTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.2-1275s1c1
Sequence:CCGGCGATCAGTGGTGTCTGTGAAGCTCGAGCTTCACAGACACCACTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003674.2-1207s1c1
Sequence:CCGGGCCAGAGCAAGCGCTGTAAACCTCGAGGTTTACAGCGCTTGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.2-1496s1c1
Sequence:CCGGCATGTGGTCCTCCTCGCTATGCTCGAGCATAGCGAGGAGGACCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.2-916s1c1
Sequence:CCGGGCACGCCCAGTGAGAACATCTCTCGAGAGATGTTCTCACTGGGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003674.x-1571s1c1
Sequence:CCGGCTGTCTTTGAGTTGTGGTGGACTCGAGTCCACCACAACTCAAAGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.x-1046s1c1
Sequence:CCGGGCTGCACTTCCTGTTCATGTACTCGAGTACATGAACAGGAAGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003674.x-332s1c1
Sequence:CCGGAGATGAGATTGTCGCACTGAACTCGAGTTCAGTGCGACAATCTCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003674.x-1055s1c1
Sequence:CCGGCCTGTTCATGTACGACCCTAACTCGAGTTAGGGTCGTACATGAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003674.x-992s1c1
Sequence:CCGGCTACAACAACCTGAAGCACAACTCGAGTTGTGCTTCAGGTTGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052987
VALIDATED
CDK10 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052987.x-1288s1c1
Sequence:CCGGCCGCTGTCTTTGAGTTGTGGTCTCGAGACCACAACTCAAAGACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052987.x-909s1c1
Sequence:CCGGCCTGTTCATGTACGACCCTAACTCGAGTTAGGGTCGTACATGAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052987.x-186s1c1
Sequence:CCGGAGATGAGATTGTCGCACTGAACTCGAGTTCAGTGCGACAATCTCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052987.x-900s1c1
Sequence:CCGGGCTGCACTTCCTGTTCATGTACTCGAGTACATGAACAGGAAGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052987.x-648s1c1
Sequence:CCGGGCAGACCACCAGCATCGACATCTCGAGATGTCGATGCTGGTGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052987.2-846s21c1
Sequence:CCGGCTACAACAACCTGAAGCACAACTCGAGTTGTGCTTCAGGTTGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052987.2-995s21c1
Sequence:CCGGCGATCAGTGGTGTCTGTGAAGCTCGAGCTTCACAGACACCACTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052987.2-900s21c1
Sequence:CCGGGCTGCACTTCCTGTTCATGTACTCGAGTACATGAACAGGAAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052987.2-648s21c1
Sequence:CCGGGCAGACCACCAGCATCGACATCTCGAGATGTCGATGCTGGTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052987
VALIDATED
CDK10 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052987.x-1288s1c1
Sequence:CCGGCCGCTGTCTTTGAGTTGTGGTCTCGAGACCACAACTCAAAGACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052987.x-909s1c1
Sequence:CCGGCCTGTTCATGTACGACCCTAACTCGAGTTAGGGTCGTACATGAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052987.x-186s1c1
Sequence:CCGGAGATGAGATTGTCGCACTGAACTCGAGTTCAGTGCGACAATCTCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052987.x-900s1c1
Sequence:CCGGGCTGCACTTCCTGTTCATGTACTCGAGTACATGAACAGGAAGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052987.x-648s1c1
Sequence:CCGGGCAGACCACCAGCATCGACATCTCGAGATGTCGATGCTGGTGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052987.2-846s21c1
Sequence:CCGGCTACAACAACCTGAAGCACAACTCGAGTTGTGCTTCAGGTTGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052987.2-995s21c1
Sequence:CCGGCGATCAGTGGTGTCTGTGAAGCTCGAGCTTCACAGACACCACTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052987.2-900s21c1
Sequence:CCGGGCTGCACTTCCTGTTCATGTACTCGAGTACATGAACAGGAAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052987.2-648s21c1
Sequence:CCGGGCAGACCACCAGCATCGACATCTCGAGATGTCGATGCTGGTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052987
VALIDATED
CDK10 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052987.x-1288s1c1
Sequence:CCGGCCGCTGTCTTTGAGTTGTGGTCTCGAGACCACAACTCAAAGACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052987.x-909s1c1
Sequence:CCGGCCTGTTCATGTACGACCCTAACTCGAGTTAGGGTCGTACATGAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052987.x-186s1c1
Sequence:CCGGAGATGAGATTGTCGCACTGAACTCGAGTTCAGTGCGACAATCTCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052987.x-900s1c1
Sequence:CCGGGCTGCACTTCCTGTTCATGTACTCGAGTACATGAACAGGAAGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052987.x-648s1c1
Sequence:CCGGGCAGACCACCAGCATCGACATCTCGAGATGTCGATGCTGGTGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052987.2-846s21c1
Sequence:CCGGCTACAACAACCTGAAGCACAACTCGAGTTGTGCTTCAGGTTGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052987.2-995s21c1
Sequence:CCGGCGATCAGTGGTGTCTGTGAAGCTCGAGCTTCACAGACACCACTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052987.2-900s21c1
Sequence:CCGGGCTGCACTTCCTGTTCATGTACTCGAGTACATGAACAGGAAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052987.2-648s21c1
Sequence:CCGGGCAGACCACCAGCATCGACATCTCGAGATGTCGATGCTGGTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194444
VALIDATED
CDK10 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194444.1-648s1c1
Sequence:CCGGCCAGACTACCAGCATTGACATCTCGAGATGTCAATGCTGGTAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194444.1-462s1c1
Sequence:CCGGCCTGCACAGGAACTTCATCATCTCGAGATGATGAAGTTCCTGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194444.1-830s1c1
Sequence:CCGGGCTTGAGGAAACAGCCCTATACTCGAGTATAGGGCTGTTTCCTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194444.1-909s1c1
Sequence:CCGGCCTCTTCATGTATGACCCTAACTCGAGTTAGGGTCATACATGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194444.1-527s1c1
Sequence:CCGGGCTGTGTAAAGACAGCTGATTCTCGAGAATCAGCTGTCTTTACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_194444.2-561s21c1
Sequence:CCGGGGCCTATGGTGTTCCAGTAAACTCGAGTTTACTGGAACACCATAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_194444.2-1332s21c1
Sequence:CCGGCTAGTGCTGAGAGGCCTAAAGCTCGAGCTTTAGGCCTCTCAGCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_194444.2-458s21c1
Sequence:CCGGAGTACCTGCACAGGAACTTCACTCGAGTGAAGTTCCTGTGCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_194444.2-832s21c1
Sequence:CCGGTTGAGGAAACAGCCCTATAACCTCGAGGTTATAGGGCTGTTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194444
VALIDATED
CDK10 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194444.1-648s1c1
Sequence:CCGGCCAGACTACCAGCATTGACATCTCGAGATGTCAATGCTGGTAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194444.1-462s1c1
Sequence:CCGGCCTGCACAGGAACTTCATCATCTCGAGATGATGAAGTTCCTGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194444.1-830s1c1
Sequence:CCGGGCTTGAGGAAACAGCCCTATACTCGAGTATAGGGCTGTTTCCTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194444.1-909s1c1
Sequence:CCGGCCTCTTCATGTATGACCCTAACTCGAGTTAGGGTCATACATGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194444.1-527s1c1
Sequence:CCGGGCTGTGTAAAGACAGCTGATTCTCGAGAATCAGCTGTCTTTACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_194444.2-561s21c1
Sequence:CCGGGGCCTATGGTGTTCCAGTAAACTCGAGTTTACTGGAACACCATAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_194444.2-1332s21c1
Sequence:CCGGCTAGTGCTGAGAGGCCTAAAGCTCGAGCTTTAGGCCTCTCAGCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_194444.2-458s21c1
Sequence:CCGGAGTACCTGCACAGGAACTTCACTCGAGTGAAGTTCCTGTGCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_194444.2-832s21c1
Sequence:CCGGTTGAGGAAACAGCCCTATAACCTCGAGGTTATAGGGCTGTTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194444
VALIDATED
CDK10 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194444.1-648s1c1
Sequence:CCGGCCAGACTACCAGCATTGACATCTCGAGATGTCAATGCTGGTAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194444.1-462s1c1
Sequence:CCGGCCTGCACAGGAACTTCATCATCTCGAGATGATGAAGTTCCTGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194444.1-830s1c1
Sequence:CCGGGCTTGAGGAAACAGCCCTATACTCGAGTATAGGGCTGTTTCCTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194444.1-909s1c1
Sequence:CCGGCCTCTTCATGTATGACCCTAACTCGAGTTAGGGTCATACATGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194444.1-527s1c1
Sequence:CCGGGCTGTGTAAAGACAGCTGATTCTCGAGAATCAGCTGTCTTTACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_194444.2-561s21c1
Sequence:CCGGGGCCTATGGTGTTCCAGTAAACTCGAGTTTACTGGAACACCATAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_194444.2-1332s21c1
Sequence:CCGGCTAGTGCTGAGAGGCCTAAAGCTCGAGCTTTAGGCCTCTCAGCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_194444.2-458s21c1
Sequence:CCGGAGTACCTGCACAGGAACTTCACTCGAGTGAAGTTCCTGTGCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_194444.2-832s21c1
Sequence:CCGGTTGAGGAAACAGCCCTATAACCTCGAGGTTATAGGGCTGTTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks