EMAIL THIS PAGE TO A FRIEND

CDK11A

cyclin-dependent kinase 11A

44 Gene Product Result for
Synonyms: CDC2L2 CDC2L3 CDK11-p110 CDK11-p46 CDK11-p58 PITSLRE p58GTA
Gene ID:
Human(728642) Summary: This gene encodes a member of the p34Cdc2 protein kinase family. p34Cdc2 kinase family members are known to be essential for eukaryotic cell cycle control. This gene is in close proximity to CDC2L1, a nearly identical gene in the same chromosomal region. The gene loci including this gene, CDC2L1, as well as metalloprotease MMP21/22, consist of two identical, tandemly linked genomic regions, which are thought to be a part of the larger region that has been duplicated. This gene and CDC2L1 were shown to be deleted or altered frequently in neuroblastoma with amplified MYCN genes. The protein kinase encoded by this gene could be cleaved by caspases and was demonstrated to play roles in cell apoptosis. Many transcript variants encoding several different isoforms have been found for this gene, but the full-length nature of only two have been determined so far. [provided by RefSeq, Jul 2008]
dog(489591) cyclin-dependent kinase 11A
Horse(100033941) cyclin-dependent kinase 11A
naked mole-rat(101714919) cyclin-dependent kinase 11A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024011 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114721 MISSION® esiRNA esiRNA human CDC2L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024011 Rosetta Predictions human pricing
NM_033529 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356428 predicted 1433
2 SASI_Hs02_00356429 predicted 1976
3 SASI_Hs02_00356430 predicted 1489
4 SASI_Hs02_00356431 predicted 1393
5 SASI_Hs02_00356432 predicted 1585
6 SASI_Hs02_00356433 predicted 1453
7 SASI_Hs02_00356434 predicted 1545
8 SASI_Hs02_00356435 predicted 2207
9 SASI_Hs02_00356436 predicted 1449
10 SASI_Hs02_00356437 predicted 1291
11 SASI_Hs01_00060444 predicted 692
12 SASI_Hs01_00060445 predicted 723
13 SASI_Hs01_00060446 predicted 697
14 SASI_Hs01_00060447 predicted 684
15 SASI_Hs01_00060448 predicted 694
16 SASI_Hs01_00060449 predicted 723
17 SASI_Hs01_00060450 predicted 697
18 SASI_Hs01_00060451 predicted 668
19 SASI_Hs01_00060452 predicted 718
20 SASI_Hs01_00060453 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115037 predicted 1408
2 SASI_Hs01_00115038 predicted 1942
3 SASI_Hs01_00115039 predicted 1466
4 SASI_Hs01_00115040 predicted 1370
5 SASI_Hs01_00115045 predicted 1555
6 SASI_Hs01_00115041 predicted 1426
7 SASI_Hs01_00115042 predicted 1511
8 SASI_Hs01_00115043 predicted 2180
9 SASI_Hs02_00361408 predicted 1264
10 SASI_Hs02_00361409 predicted 1590
11 SASI_Hs01_00115036 predicted 1993
12 SASI_Hs01_00115044 predicted 1389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024011
VALIDATED
CDK11A MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 11A
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024011.2-2059s21c1
Sequence:GTACCGGAGTGAGCTCCCAGTAGTCAAACTCGAGTTTGACTACTGGGAGCTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-2212s21c1
Sequence:GTACCGGGGCCTCAAGCATGAGTATTTCCTCGAGGAAATACTCATGCTTGAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-432s21c1
Sequence:GTACCGGATGTAGGCATCATAGCCATTCCTCGAGGAATGGCTATGATGCCTACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1785s21c1
Sequence:GTACCGGCATCCTCAAGGTGGGTGATTTCTCGAGAAATCACCCACCTTGAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-274s21c1
Sequence:GTACCGGCACTGCATGGAGATCACAATACTCGAGTATTGTGATCTCCATGCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1136s21c1
Sequence:GTACCGGGTGAAGATGAAGAACGAGAAACTCGAGTTTCTCGTTCTTCATCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1637s21c1
Sequence:GTACCGGGCCTGATGGAGACCATGAAACCTCGAGGTTTCATGGTCTCCATCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-464s21c1
Sequence:GTACCGGGGAAGCATGCTAGAGTGAAAGCTCGAGCTTTCACTCTAGCATGCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-764s21c1
Sequence:GTACCGGACTACAGCGACAAAGTGAAAGCTCGAGCTTTCACTTTGTCGCTGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-307s21c1
Sequence:GTACCGGTATAGAAGAGAAGACTCAATGCTCGAGCATTGAGTCTTCTCTTCTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1443s21c1
Sequence:GTACCGGAGATGAAATTGTGGCTCTAAACTCGAGTTTAGAGCCACAATTTCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-186s21c1
Sequence:GTACCGGAGAGGAGAAAGCAGAGATAAACTCGAGTTTATCTCTGCTTTCTCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1887s21c1
Sequence:GTACCGGGCTGCTTGGTGCCAAGGAATACTCGAGTATTCCTTGGCACCAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024011.1-2026s1c1
Sequence:CCGGGCTCCCAGTAGTCAAGAAGATCTCGAGATCTTCTTGACTACTGGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024011.1-1505s1c1
Sequence:CCGGCATCCCAACATTGTCACCGTTCTCGAGAACGGTGACAATGTTGGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024011.1-1542s1c1
Sequence:CCGGGCAGCAACATGGACAAGATCTCTCGAGAGATCTTGTCCATGTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024011
VALIDATED
CDK11A MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 11A
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024011.2-2059s21c1
Sequence:GTACCGGAGTGAGCTCCCAGTAGTCAAACTCGAGTTTGACTACTGGGAGCTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-2212s21c1
Sequence:GTACCGGGGCCTCAAGCATGAGTATTTCCTCGAGGAAATACTCATGCTTGAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-432s21c1
Sequence:GTACCGGATGTAGGCATCATAGCCATTCCTCGAGGAATGGCTATGATGCCTACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1785s21c1
Sequence:GTACCGGCATCCTCAAGGTGGGTGATTTCTCGAGAAATCACCCACCTTGAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-274s21c1
Sequence:GTACCGGCACTGCATGGAGATCACAATACTCGAGTATTGTGATCTCCATGCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1136s21c1
Sequence:GTACCGGGTGAAGATGAAGAACGAGAAACTCGAGTTTCTCGTTCTTCATCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1637s21c1
Sequence:GTACCGGGCCTGATGGAGACCATGAAACCTCGAGGTTTCATGGTCTCCATCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-464s21c1
Sequence:GTACCGGGGAAGCATGCTAGAGTGAAAGCTCGAGCTTTCACTCTAGCATGCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-764s21c1
Sequence:GTACCGGACTACAGCGACAAAGTGAAAGCTCGAGCTTTCACTTTGTCGCTGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-307s21c1
Sequence:GTACCGGTATAGAAGAGAAGACTCAATGCTCGAGCATTGAGTCTTCTCTTCTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1443s21c1
Sequence:GTACCGGAGATGAAATTGTGGCTCTAAACTCGAGTTTAGAGCCACAATTTCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-186s21c1
Sequence:GTACCGGAGAGGAGAAAGCAGAGATAAACTCGAGTTTATCTCTGCTTTCTCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1887s21c1
Sequence:GTACCGGGCTGCTTGGTGCCAAGGAATACTCGAGTATTCCTTGGCACCAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024011.1-2026s1c1
Sequence:CCGGGCTCCCAGTAGTCAAGAAGATCTCGAGATCTTCTTGACTACTGGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024011.1-1505s1c1
Sequence:CCGGCATCCCAACATTGTCACCGTTCTCGAGAACGGTGACAATGTTGGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024011.1-1542s1c1
Sequence:CCGGGCAGCAACATGGACAAGATCTCTCGAGAGATCTTGTCCATGTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024011
VALIDATED
CDK11A MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 11A
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024011.2-2059s21c1
Sequence:GTACCGGAGTGAGCTCCCAGTAGTCAAACTCGAGTTTGACTACTGGGAGCTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-2212s21c1
Sequence:GTACCGGGGCCTCAAGCATGAGTATTTCCTCGAGGAAATACTCATGCTTGAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-432s21c1
Sequence:GTACCGGATGTAGGCATCATAGCCATTCCTCGAGGAATGGCTATGATGCCTACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1785s21c1
Sequence:GTACCGGCATCCTCAAGGTGGGTGATTTCTCGAGAAATCACCCACCTTGAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-274s21c1
Sequence:GTACCGGCACTGCATGGAGATCACAATACTCGAGTATTGTGATCTCCATGCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1136s21c1
Sequence:GTACCGGGTGAAGATGAAGAACGAGAAACTCGAGTTTCTCGTTCTTCATCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1637s21c1
Sequence:GTACCGGGCCTGATGGAGACCATGAAACCTCGAGGTTTCATGGTCTCCATCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-464s21c1
Sequence:GTACCGGGGAAGCATGCTAGAGTGAAAGCTCGAGCTTTCACTCTAGCATGCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-764s21c1
Sequence:GTACCGGACTACAGCGACAAAGTGAAAGCTCGAGCTTTCACTTTGTCGCTGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-307s21c1
Sequence:GTACCGGTATAGAAGAGAAGACTCAATGCTCGAGCATTGAGTCTTCTCTTCTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1443s21c1
Sequence:GTACCGGAGATGAAATTGTGGCTCTAAACTCGAGTTTAGAGCCACAATTTCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-186s21c1
Sequence:GTACCGGAGAGGAGAAAGCAGAGATAAACTCGAGTTTATCTCTGCTTTCTCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024011.2-1887s21c1
Sequence:GTACCGGGCTGCTTGGTGCCAAGGAATACTCGAGTATTCCTTGGCACCAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024011.1-2026s1c1
Sequence:CCGGGCTCCCAGTAGTCAAGAAGATCTCGAGATCTTCTTGACTACTGGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024011.1-1505s1c1
Sequence:CCGGCATCCCAACATTGTCACCGTTCTCGAGAACGGTGACAATGTTGGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024011.1-1542s1c1
Sequence:CCGGGCAGCAACATGGACAAGATCTCTCGAGAGATCTTGTCCATGTTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)