EMAIL THIS PAGE TO A FRIEND

CDK11B

cyclin-dependent kinase 11B

132 Gene Product Result for
Synonyms: CDC2L1 CDK11 CDK11-p110 CDK11-p46 CDK11-p58 CLK-1 PK58 p58 p58CDC2L1 p58CLK-1
Gene ID:
Human(984) Summary: This gene encodes a member of the p34Cdc2 protein kinase family. p34Cdc2 kinase family members are known to be essential for eukaryotic cell cycle control. This gene is in close proximity to CDC2L2, a nearly identical gene in the same chromosomal region. The gene loci including this gene, CDC2L2, as well as metalloprotease MMP21/22, consist of two identical, tandemly linked genomic regions which are thought to be a part of the larger region that has been duplicated. This gene and CDC2L2 were shown to be deleted or altered frequently in neuroblastoma with amplified MYCN genes. The protein kinase encoded by this gene could be cleaved by caspases and was demonstrated to play roles in cell apoptosis. Several alternatively spliced variants of this gene have been reported. [provided by RefSeq, Jul 2008]
Mouse(12537) cyclin-dependent kinase 11B
Rat(252879) cyclin-dependent kinase 11B
Zebrafish(494103) cyclin-dependent kinase 11B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001787 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001787 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001787 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007661 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007661 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007661 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033493 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU084531 MISSION® esiRNA esiRNA targeting mouse Cdc2l1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001787 Rosetta Predictions human pricing
NM_033486 Rosetta Predictions human pricing
NM_033487 Rosetta Predictions human pricing
NM_033488 Rosetta Predictions human pricing
NM_033489 siRNAs that have been validated in the lab human pricing
NM_033490 Rosetta Predictions human pricing
NM_033492 Rosetta Predictions human pricing
NM_033493 Rosetta Predictions human pricing
NM_145766 Rosetta Predictions rat pricing
NM_007661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202566 predicted 1494
2 SASI_Hs01_00202567 predicted 1592
3 SASI_Hs01_00202568 predicted 1932
4 SASI_Hs01_00202569 predicted 1625
5 SASI_Hs01_00202570 predicted 1548
6 SASI_Hs01_00202571 predicted 1452
7 SASI_Hs01_00202572 predicted 2115
8 SASI_Hs01_00202573 predicted 1507
9 SASI_Hs01_00202574 predicted 2266
10 SASI_Hs01_00202575 predicted 1503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185038 predicted 1442
2 SASI_Hs01_00185039 predicted 1550
3 SASI_Hs01_00185040 predicted 1895
4 SASI_Hs01_00185041 predicted 1587
5 SASI_Hs01_00185042 predicted 1503
6 SASI_Hs01_00185043 predicted 1410
7 SASI_Hs01_00185044 predicted 2077
8 SASI_Hs01_00185045 predicted 1459
9 SASI_Hs01_00185046 predicted 2214
10 SASI_Hs01_00185047 predicted 1457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114606 predicted 1188
2 SASI_Hs01_00114607 predicted 1292
3 SASI_Hs01_00114608 predicted 1629
4 SASI_Hs01_00114609 predicted 1323
5 SASI_Hs01_00114610 predicted 1247
6 SASI_Hs01_00114611 predicted 1149
7 SASI_Hs01_00114612 predicted 1811
8 SASI_Hs01_00114613 predicted 1197
9 SASI_Hs01_00114614 predicted 1960
10 SASI_Hs01_00114615 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163056 predicted 1458
2 SASI_Hs01_00163057 predicted 1566
3 SASI_Hs01_00163058 predicted 1902
4 SASI_Hs01_00163059 predicted 1594
5 SASI_Hs01_00163060 predicted 1515
6 SASI_Hs01_00163061 predicted 1422
7 SASI_Hs01_00163062 predicted 2094
8 SASI_Hs01_00163063 predicted 1470
9 SASI_Hs01_00163064 predicted 2234
10 SASI_Hs01_00163065 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033489 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000026 validated 2272
1 SASI_WI_00000027 validated 327
2 SASI_Hs01_00018614 predicted 1491
3 SASI_Hs01_00018615 predicted 1597
4 SASI_Hs01_00018616 predicted 1934
5 SASI_Hs01_00018617 predicted 1634
6 SASI_Hs01_00018618 predicted 1546
7 SASI_Hs01_00018619 predicted 1456
8 SASI_Hs01_00018620 predicted 2120
9 SASI_Hs01_00018621 predicted 1509
10 SASI_Hs01_00018622 predicted 2261
11 SASI_Hs01_00018623 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049165 predicted 1313
2 SASI_Hs01_00049166 predicted 1420
3 SASI_Hs01_00049167 predicted 1757
4 SASI_Hs01_00049168 predicted 1455
5 SASI_Hs01_00049169 predicted 1366
6 SASI_Hs01_00049170 predicted 1280
7 SASI_Hs01_00049171 predicted 1945
8 SASI_Hs01_00049172 predicted 1330
9 SASI_Hs01_00049173 predicted 2083
10 SASI_Hs01_00049174 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134220 predicted 1442
2 SASI_Hs01_00134221 predicted 1548
3 SASI_Hs01_00134222 predicted 1888
4 SASI_Hs01_00134223 predicted 1582
5 SASI_Hs01_00134224 predicted 1499
6 SASI_Hs01_00134225 predicted 1399
7 SASI_Hs01_00134226 predicted 2069
8 SASI_Hs01_00134227 predicted 1452
9 SASI_Hs01_00134228 predicted 2207
10 SASI_Hs01_00134229 predicted 1453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218089 predicted 1415
2 SASI_Hs01_00218090 predicted 1519
3 SASI_Hs01_00218091 predicted 1857
4 SASI_Hs01_00218092 predicted 1549
5 SASI_Hs01_00218093 predicted 1471
6 SASI_Hs01_00218094 predicted 1370
7 SASI_Hs01_00218095 predicted 2043
8 SASI_Hs01_00218096 predicted 1423
9 SASI_Hs01_00218097 predicted 2179
10 SASI_Hs01_00218098 predicted 1431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268748 predicted 906
2 SASI_Rn01_00036912 predicted 557
3 SASI_Rn01_00036903 predicted 1176
4 SASI_Rn02_00268749 predicted 906
5 SASI_Rn01_00036906 predicted 1088
6 SASI_Rn01_00036908 predicted 469
7 SASI_Rn02_00268750 predicted 1412
8 SASI_Rn01_00036909 predicted 472
9 SASI_Rn01_00036911 predicted 1185
10 SASI_Rn02_00268751 predicted 1547
11 SASI_Rn01_00036904 predicted 1046
12 SASI_Rn01_00036905 predicted 1333
13 SASI_Rn01_00036907 predicted 1077
14 SASI_Rn01_00036910 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188219 predicted 2087
2 SASI_Mm01_00188221 predicted 1566
3 SASI_Mm01_00188222 predicted 1360
4 SASI_Mm01_00188223 predicted 277
5 SASI_Mm01_00188224 predicted 268
6 SASI_Mm02_00312162 predicted 725
7 SASI_Mm02_00312163 predicted 540
8 SASI_Mm01_00188225 predicted 1613
9 SASI_Mm01_00188226 predicted 1364
10 SASI_Mm02_00312164 predicted 401
11 SASI_Mm01_00188220 predicted 292
12 SASI_Mm01_00188227 predicted 1571
13 SASI_Mm01_00188228 predicted 1326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001787
CDK11B MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 11B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-2119s1c1
Sequence:CCGGGCAGTCAAGAAGATGACCTTCCTCGAGGAAGGTCATCTTCTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-888s1c1
Sequence:CCGGGCAGAAGCCAGCACAGTTAAACTCGAGTTTAACTGTGCTGGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-2031s1c1
Sequence:CCGGGAAGTCAGAAATCGATCAGATCTCGAGATCTGATCGATTTCTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-349s1c1
Sequence:CCGGGATGATTCTTTGGCCATCAAACTCGAGTTTGATGGCCAAAGAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-1492s1c1
Sequence:CCGGGATGAAATTGTGGCTCTAAAGCTCGAGCTTTAGAGCCACAATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-1156s1c1
Sequence:CCGGGCCGAAGAAGTAAGTGAGGAACTCGAGTTCCTCACTTACTTCTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-2043s1c1
Sequence:CCGGCGATCAGATCAACAAGGTGTTCTCGAGAACACCTTGTTGATCTGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-2259s1c1
Sequence:CCGGCGGCCTCAAGCATGAGTATTTCTCGAGAAATACTCATGCTTGAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-511s1c1
Sequence:CCGGCGGAAACGACATCGAGAAGAACTCGAGTTCTTCTCGATGTCGTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001787.1-987s1c1
Sequence:CCGGCGAGTCCTCGTCAGCAGAATCCTCGAGGATTCTGCTGACGAGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001787
CDK11B MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 11B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-2119s1c1
Sequence:CCGGGCAGTCAAGAAGATGACCTTCCTCGAGGAAGGTCATCTTCTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-888s1c1
Sequence:CCGGGCAGAAGCCAGCACAGTTAAACTCGAGTTTAACTGTGCTGGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-2031s1c1
Sequence:CCGGGAAGTCAGAAATCGATCAGATCTCGAGATCTGATCGATTTCTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-349s1c1
Sequence:CCGGGATGATTCTTTGGCCATCAAACTCGAGTTTGATGGCCAAAGAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-1492s1c1
Sequence:CCGGGATGAAATTGTGGCTCTAAAGCTCGAGCTTTAGAGCCACAATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-1156s1c1
Sequence:CCGGGCCGAAGAAGTAAGTGAGGAACTCGAGTTCCTCACTTACTTCTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-2043s1c1
Sequence:CCGGCGATCAGATCAACAAGGTGTTCTCGAGAACACCTTGTTGATCTGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-2259s1c1
Sequence:CCGGCGGCCTCAAGCATGAGTATTTCTCGAGAAATACTCATGCTTGAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-511s1c1
Sequence:CCGGCGGAAACGACATCGAGAAGAACTCGAGTTCTTCTCGATGTCGTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001787.1-987s1c1
Sequence:CCGGCGAGTCCTCGTCAGCAGAATCCTCGAGGATTCTGCTGACGAGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001787
CDK11B MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 11B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-2119s1c1
Sequence:CCGGGCAGTCAAGAAGATGACCTTCCTCGAGGAAGGTCATCTTCTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-888s1c1
Sequence:CCGGGCAGAAGCCAGCACAGTTAAACTCGAGTTTAACTGTGCTGGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-2031s1c1
Sequence:CCGGGAAGTCAGAAATCGATCAGATCTCGAGATCTGATCGATTTCTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-349s1c1
Sequence:CCGGGATGATTCTTTGGCCATCAAACTCGAGTTTGATGGCCAAAGAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-1492s1c1
Sequence:CCGGGATGAAATTGTGGCTCTAAAGCTCGAGCTTTAGAGCCACAATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-1156s1c1
Sequence:CCGGGCCGAAGAAGTAAGTGAGGAACTCGAGTTCCTCACTTACTTCTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-2043s1c1
Sequence:CCGGCGATCAGATCAACAAGGTGTTCTCGAGAACACCTTGTTGATCTGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-2259s1c1
Sequence:CCGGCGGCCTCAAGCATGAGTATTTCTCGAGAAATACTCATGCTTGAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001787.1-511s1c1
Sequence:CCGGCGGAAACGACATCGAGAAGAACTCGAGTTCTTCTCGATGTCGTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001787.1-987s1c1
Sequence:CCGGCGAGTCCTCGTCAGCAGAATCCTCGAGGATTCTGCTGACGAGGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007661
CDK11B MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 11B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-1832s1c1
Sequence:CCGGCCTACACTCCAGTTGTTGTAACTCGAGTTACAACAACTGGAGTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-451s1c1
Sequence:CCGGGCCAGAGTGAAAGAGAAAGAACTCGAGTTCTTTCTCTTTCACTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-922s1c1
Sequence:CCGGGCTGAGTCTTCATCAGCAGAACTCGAGTTCTGCTGATGAAGACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-1969s1c1
Sequence:CCGGCCTGGGAAGTCAGATATTGATCTCGAGATCAATATCTGACTTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-1597s1c1
Sequence:CCGGGTGATGAACTACGTGGAACATCTCGAGATGTTCCACGTAGTTCATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007661.3-2200s21c1
Sequence:CCGGATGGCCTCAAGCACGAATATTCTCGAGAATATTCGTGCTTGAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007661.3-2079s21c1
Sequence:CCGGTTCAGCGAGTATCCCTATAACCTCGAGGTTATAGGGATACTCGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007661.3-1442s21c1
Sequence:CCGGTGTGGCTCTGAAGCGGTTAAACTCGAGTTTAACCGCTTCAGAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007661.3-1918s21c1
Sequence:CCGGGGTCGGTAGGCTGCATATTTGCTCGAGCAAATATGCAGCCTACCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007661
CDK11B MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 11B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-1832s1c1
Sequence:CCGGCCTACACTCCAGTTGTTGTAACTCGAGTTACAACAACTGGAGTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-451s1c1
Sequence:CCGGGCCAGAGTGAAAGAGAAAGAACTCGAGTTCTTTCTCTTTCACTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-922s1c1
Sequence:CCGGGCTGAGTCTTCATCAGCAGAACTCGAGTTCTGCTGATGAAGACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-1969s1c1
Sequence:CCGGCCTGGGAAGTCAGATATTGATCTCGAGATCAATATCTGACTTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-1597s1c1
Sequence:CCGGGTGATGAACTACGTGGAACATCTCGAGATGTTCCACGTAGTTCATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007661.3-2200s21c1
Sequence:CCGGATGGCCTCAAGCACGAATATTCTCGAGAATATTCGTGCTTGAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007661.3-2079s21c1
Sequence:CCGGTTCAGCGAGTATCCCTATAACCTCGAGGTTATAGGGATACTCGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007661.3-1442s21c1
Sequence:CCGGTGTGGCTCTGAAGCGGTTAAACTCGAGTTTAACCGCTTCAGAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007661.3-1918s21c1
Sequence:CCGGGGTCGGTAGGCTGCATATTTGCTCGAGCAAATATGCAGCCTACCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007661
CDK11B MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 11B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-1832s1c1
Sequence:CCGGCCTACACTCCAGTTGTTGTAACTCGAGTTACAACAACTGGAGTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-451s1c1
Sequence:CCGGGCCAGAGTGAAAGAGAAAGAACTCGAGTTCTTTCTCTTTCACTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-922s1c1
Sequence:CCGGGCTGAGTCTTCATCAGCAGAACTCGAGTTCTGCTGATGAAGACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-1969s1c1
Sequence:CCGGCCTGGGAAGTCAGATATTGATCTCGAGATCAATATCTGACTTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007661.2-1597s1c1
Sequence:CCGGGTGATGAACTACGTGGAACATCTCGAGATGTTCCACGTAGTTCATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007661.3-2200s21c1
Sequence:CCGGATGGCCTCAAGCACGAATATTCTCGAGAATATTCGTGCTTGAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007661.3-2079s21c1
Sequence:CCGGTTCAGCGAGTATCCCTATAACCTCGAGGTTATAGGGATACTCGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007661.3-1442s21c1
Sequence:CCGGTGTGGCTCTGAAGCGGTTAAACTCGAGTTTAACCGCTTCAGAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007661.3-1918s21c1
Sequence:CCGGGGTCGGTAGGCTGCATATTTGCTCGAGCAAATATGCAGCCTACCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033493
VALIDATED
CDK11B MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 11B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033493.1-1971s21c1
Sequence:CCGGCGATCAGATCAACAAGGTGTTCTCGAGAACACCTTGTTGATCTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-2186s21c1
Sequence:CCGGACGGCCTCAAGCATGAGTATTCTCGAGAATACTCATGCTTGAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-478s21c1
Sequence:CCGGCGGAAACGACATCGAGAAGAACTCGAGTTCTTCTCGATGTCGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033493.1-734s21c1
Sequence:CCGGGAGAGGACTACAGCGACAAAGCTCGAGCTTTGTCGCTGTAGTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-1574s21c1
Sequence:CCGGTCTACATCGTGATGAACTATGCTCGAGCATAGTTCATCACGATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-576s21c1
Sequence:CCGGCCGCTTGGAGCAGTTAGAAAGCTCGAGCTTTCTAACTGCTCCAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-350s21c1
Sequence:CCGGATGATTCTTTGGCCATCAAACCTCGAGGTTTGATGGCCAAAGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033493
VALIDATED
CDK11B MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 11B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033493.1-1971s21c1
Sequence:CCGGCGATCAGATCAACAAGGTGTTCTCGAGAACACCTTGTTGATCTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-2186s21c1
Sequence:CCGGACGGCCTCAAGCATGAGTATTCTCGAGAATACTCATGCTTGAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-478s21c1
Sequence:CCGGCGGAAACGACATCGAGAAGAACTCGAGTTCTTCTCGATGTCGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033493.1-734s21c1
Sequence:CCGGGAGAGGACTACAGCGACAAAGCTCGAGCTTTGTCGCTGTAGTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-1574s21c1
Sequence:CCGGTCTACATCGTGATGAACTATGCTCGAGCATAGTTCATCACGATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-576s21c1
Sequence:CCGGCCGCTTGGAGCAGTTAGAAAGCTCGAGCTTTCTAACTGCTCCAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-350s21c1
Sequence:CCGGATGATTCTTTGGCCATCAAACCTCGAGGTTTGATGGCCAAAGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033493
VALIDATED
CDK11B MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 11B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033493.1-1971s21c1
Sequence:CCGGCGATCAGATCAACAAGGTGTTCTCGAGAACACCTTGTTGATCTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-2186s21c1
Sequence:CCGGACGGCCTCAAGCATGAGTATTCTCGAGAATACTCATGCTTGAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-478s21c1
Sequence:CCGGCGGAAACGACATCGAGAAGAACTCGAGTTCTTCTCGATGTCGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_033493.1-734s21c1
Sequence:CCGGGAGAGGACTACAGCGACAAAGCTCGAGCTTTGTCGCTGTAGTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-1574s21c1
Sequence:CCGGTCTACATCGTGATGAACTATGCTCGAGCATAGTTCATCACGATGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-576s21c1
Sequence:CCGGCCGCTTGGAGCAGTTAGAAAGCTCGAGCTTTCTAACTGCTCCAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033493.1-350s21c1
Sequence:CCGGATGATTCTTTGGCCATCAAACCTCGAGGTTTGATGGCCAAAGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks