EMAIL THIS PAGE TO A FRIEND

CDK12

cyclin-dependent kinase 12

167 Gene Product Result for
Synonyms: CRK7 CRKR CRKRS hCDK12
UniProtKB ID: Q9NYV4, A7E2B2, B4DYX4, B9EIQ6, O94978
Gene ID:
Mouse(69131) cyclin-dependent kinase 12
Rat(192350) cyclin-dependent kinase 12
Zebrafish(334735) cyclin-dependent kinase 12
cow(511513) cyclin-dependent kinase 12
domestic cat(101090563) cyclin-dependent kinase 12
dog(491027) cyclin-dependent kinase 12
chicken(428306) cyclin-dependent kinase 12
fruit fly(40385) CG7597 gene product from transcript CG7597-RB
domestic guinea pig(100723439) cyclin-dependent kinase 12
naked mole-rat(101709676) cyclin-dependent kinase 12
sheep(101102654) cyclin-dependent kinase 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016507 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015083 Rosetta Predictions human pricing
NM_016507 Rosetta Predictions human pricing
NM_001033867 Rosetta Predictions rat pricing
NM_138916 Rosetta Predictions rat pricing
NM_001109626 Rosetta Predictions mouse pricing
NM_001109628 Rosetta Predictions mouse pricing
NM_026952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346951 predicted 1953
2 SASI_Hs02_00346952 predicted 3804
3 SASI_Hs02_00346953 predicted 3925
4 SASI_Hs02_00346954 predicted 1002
5 SASI_Hs02_00346955 predicted 1707
6 SASI_Hs02_00346956 predicted 3251
7 SASI_Hs02_00346957 predicted 1482
8 SASI_Hs02_00346958 predicted 3732
9 SASI_Hs02_00346959 predicted 1031
10 SASI_Hs02_00346960 predicted 3318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349578 predicted 1951
2 SASI_Hs02_00349579 predicted 3799
3 SASI_Hs01_00090131 predicted 3921
4 SASI_Hs01_00090133 predicted 1000
5 SASI_Hs01_00090134 predicted 1702
6 SASI_Hs01_00090136 predicted 3257
7 SASI_Hs02_00349580 predicted 1478
8 SASI_Hs02_00349581 predicted 3731
9 SASI_Hs02_00349582 predicted 1026
10 SASI_Hs02_00349583 predicted 3319
11 SASI_Hs01_00090127 predicted 2295
12 SASI_Hs01_00090128 predicted 1098
13 SASI_Hs01_00090129 predicted 3612
14 SASI_Hs01_00090130 predicted 4600
15 SASI_Hs01_00090132 predicted 1937
16 SASI_Hs01_00090135 predicted 2559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106147 predicted 3393
2 SASI_Rn02_00203768 predicted 1822
3 SASI_Rn01_00106148 predicted 1205
4 SASI_Rn01_00106149 predicted 2232
5 SASI_Rn01_00106150 predicted 3230
6 SASI_Rn01_00106152 predicted 2990
7 SASI_Rn01_00106153 predicted 1090
8 SASI_Rn01_00106154 predicted 3505
9 SASI_Rn01_00106155 predicted 876
10 SASI_Rn02_00203769 predicted 2978
11 SASI_Rn01_00106151 predicted 2359
12 SASI_Rn01_00106156 predicted 2324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114014 predicted 3392
2 SASI_Rn02_00268399 predicted 1817
3 SASI_Rn01_00114015 predicted 1205
4 SASI_Rn01_00114016 predicted 2231
5 SASI_Rn01_00114017 predicted 3229
6 SASI_Rn01_00114019 predicted 2987
7 SASI_Rn01_00114020 predicted 1088
8 SASI_Rn01_00114021 predicted 3505
9 SASI_Rn01_00114022 predicted 876
10 SASI_Rn02_00268400 predicted 2975
11 SASI_Rn01_00114018 predicted 2357
12 SASI_Rn01_00114023 predicted 2319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304074 predicted 1434
2 SASI_Mm02_00304075 predicted 3384
3 SASI_Mm02_00304076 predicted 2549
4 SASI_Mm02_00304077 predicted 1892
5 SASI_Mm02_00304078 predicted 2616
6 SASI_Mm02_00304079 predicted 2346
7 SASI_Mm02_00304080 predicted 2367
8 SASI_Mm02_00304081 predicted 2987
9 SASI_Mm02_00304082 predicted 1769
10 SASI_Mm02_00304083 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304084 predicted 1429
2 SASI_Mm02_00304085 predicted 3389
3 SASI_Mm02_00304086 predicted 2541
4 SASI_Mm02_00304087 predicted 1898
5 SASI_Mm02_00304088 predicted 2620
6 SASI_Mm02_00304089 predicted 2348
7 SASI_Mm02_00304090 predicted 2372
8 SASI_Mm02_00304091 predicted 2986
9 SASI_Mm02_00304092 predicted 1764
10 SASI_Mm02_00304093 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331271 predicted 1432
2 SASI_Mm01_00031497 predicted 3388
3 SASI_Mm01_00031498 predicted 2549
4 SASI_Mm01_00031501 predicted 1893
5 SASI_Mm02_00331272 predicted 2622
6 SASI_Mm01_00031502 predicted 2351
7 SASI_Mm02_00331273 predicted 2373
8 SASI_Mm01_00031503 predicted 2992
9 SASI_Mm01_00031504 predicted 1768
10 SASI_Mm01_00031505 predicted 931
11 SASI_Mm01_00031499 predicted 1539
12 SASI_Mm01_00031500 predicted 2654
13 SASI_Mm01_00031506 predicted 1314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026952
VALIDATED
CDK12 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 12
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026952.2-4273s21c1
Sequence:CCGGGAGCAGACAAACACCTTATATCTCGAGATATAAGGTGTTTGTCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026952.2-1573s21c1
Sequence:CCGGGCACCGAAAGAGGTGATTGTTCTCGAGAACAATCACCTCTTTCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026952.2-1124s21c1
Sequence:CCGGCCAGAAGTAGAAGTCCTGCATCTCGAGATGCAGGACTTCTACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026952.2-4211s21c1
Sequence:CCGGCAGTCAAGAAAGCCCTAATAACTCGAGTTATTAGGGCTTTCTTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026952.2-1319s21c1
Sequence:CCGGCCAAGAGTTCACCTATAATTTCTCGAGAAATTATAGGTGAACTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026952.2-2373s21c1
Sequence:CCGGGATCAAGATTCTTCGTCAATTCTCGAGAATTGACGAAGAATCTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026952.2-611s21c1
Sequence:CCGGCCCGCAAAGAGCGAGAGTTAACTCGAGTTAACTCTCGCTCTTTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026952.1-1564s1c1
Sequence:CCGGGCACCGAAAGAGGTGATTGTTCTCGAGAACAATCACCTCTTTCGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026952.1-3450s1c1
Sequence:CCGGGCTGCTTAATATCCACTCCAACTCGAGTTGGAGTGGATATTAAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026952.1-1441s1c1
Sequence:CCGGGCACATTCAAACCCAGAGGTACTCGAGTACCTCTGGGTTTGAATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026952.1-1115s1c1
Sequence:CCGGCCAGAAGTAGAAGTCCTGCATCTCGAGATGCAGGACTTCTACTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026952.1-3391s1c1
Sequence:CCGGGCAGTGTTATTAAACCTGCTTCTCGAGAAGCAGGTTTAATAACACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026952
VALIDATED
CDK12 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 12
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026952.2-4273s21c1
Sequence:CCGGGAGCAGACAAACACCTTATATCTCGAGATATAAGGTGTTTGTCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026952.2-1573s21c1
Sequence:CCGGGCACCGAAAGAGGTGATTGTTCTCGAGAACAATCACCTCTTTCGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026952.2-1124s21c1
Sequence:CCGGCCAGAAGTAGAAGTCCTGCATCTCGAGATGCAGGACTTCTACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026952.2-4211s21c1
Sequence:CCGGCAGTCAAGAAAGCCCTAATAACTCGAGTTATTAGGGCTTTCTTGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026952.2-1319s21c1
Sequence:CCGGCCAAGAGTTCACCTATAATTTCTCGAGAAATTATAGGTGAACTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026952.2-2373s21c1
Sequence:CCGGGATCAAGATTCTTCGTCAATTCTCGAGAATTGACGAAGAATCTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026952.2-611s21c1
Sequence:CCGGCCCGCAAAGAGCGAGAGTTAACTCGAGTTAACTCTCGCTCTTTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026952.1-1564s1c1
Sequence:CCGGGCACCGAAAGAGGTGATTGTTCTCGAGAACAATCACCTCTTTCGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026952.1-3450s1c1
Sequence:CCGGGCTGCTTAATATCCACTCCAACTCGAGTTGGAGTGGATATTAAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026952.1-1441s1c1
Sequence:CCGGGCACATTCAAACCCAGAGGTACTCGAGTACCTCTGGGTTTGAATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026952.1-1115s1c1
Sequence:CCGGCCAGAAGTAGAAGTCCTGCATCTCGAGATGCAGGACTTCTACTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026952.1-3391s1c1
Sequence:CCGGGCAGTGTTATTAAACCTGCTTCTCGAGAAGCAGGTTTAATAACACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026952
VALIDATED
CDK12 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 12
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026952.2-4273s21c1
Sequence:CCGGGAGCAGACAAACACCTTATATCTCGAGATATAAGGTGTTTGTCTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026952.2-1573s21c1
Sequence:CCGGGCACCGAAAGAGGTGATTGTTCTCGAGAACAATCACCTCTTTCGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026952.2-1124s21c1
Sequence:CCGGCCAGAAGTAGAAGTCCTGCATCTCGAGATGCAGGACTTCTACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026952.2-4211s21c1
Sequence:CCGGCAGTCAAGAAAGCCCTAATAACTCGAGTTATTAGGGCTTTCTTGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026952.2-1319s21c1
Sequence:CCGGCCAAGAGTTCACCTATAATTTCTCGAGAAATTATAGGTGAACTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026952.2-2373s21c1
Sequence:CCGGGATCAAGATTCTTCGTCAATTCTCGAGAATTGACGAAGAATCTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026952.2-611s21c1
Sequence:CCGGCCCGCAAAGAGCGAGAGTTAACTCGAGTTAACTCTCGCTCTTTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026952.1-1564s1c1
Sequence:CCGGGCACCGAAAGAGGTGATTGTTCTCGAGAACAATCACCTCTTTCGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026952.1-3450s1c1
Sequence:CCGGGCTGCTTAATATCCACTCCAACTCGAGTTGGAGTGGATATTAAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026952.1-1441s1c1
Sequence:CCGGGCACATTCAAACCCAGAGGTACTCGAGTACCTCTGGGTTTGAATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026952.1-1115s1c1
Sequence:CCGGCCAGAAGTAGAAGTCCTGCATCTCGAGATGCAGGACTTCTACTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026952.1-3391s1c1
Sequence:CCGGGCAGTGTTATTAAACCTGCTTCTCGAGAAGCAGGTTTAATAACACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016507
VALIDATED
CDK12 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 12
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-3219s21c1
Sequence:CCGGTTGGACTTGCTCGGCTCTATACTCGAGTATAGAGCCGAGCAAGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016507.2-5312s21c1
Sequence:CCGGAGAATATGGAGAGGATCATTACTCGAGTAATGATCCTCTCCATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-1163s21c1
Sequence:CCGGGGGCACAAAGACCGGAGTAAACTCGAGTTTACTCCGGTCTTTGTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016507.2-5213s21c1
Sequence:CCGGAGCAGGCGACTTACGAAATAACTCGAGTTATTTCGTAAGTCGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-1009s21c1
Sequence:CCGGATCGATGAAGGACCGGATATCCTCGAGGATATCCGGTCCTTCATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-1711s21c1
Sequence:CCGGCAGTTCACGCAGTCGTCATTCCTCGAGGAATGACGACTGCGTGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-2792s21c1
Sequence:CCGGGGAACCTATGGCCAAGTATATCTCGAGATATACTTGGCCATAGGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-2663s21c1
Sequence:CCGGCCACCTCAGCAACCATATAAACTCGAGTTTATATGGTTGCTGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-3014s21c1
Sequence:CCGGTACCTTGTATTTGAGTATATGCTCGAGCATATACTCAAATACAAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016507.2-7066s21c1
Sequence:CCGGCTATTGGTAAATCGCATTAAACTCGAGTTTAATGCGATTTACCAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-703s21c1
Sequence:CCGGATCGAAGCACAAGCGGCATAACTCGAGTTATGCCGCTTGTGCTTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016507.2-937s21c1
Sequence:CCGGGCGTTCCCGGGACTTACTAAACTCGAGTTTAGTAAGTCCCGGGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-3147s21c1
Sequence:CCGGATTTCCTGCATCGGGATATTACTCGAGTAATATCCCGATGCAGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016507.x-2674s1c1
Sequence:CCGGGCTCGGCTCTATAACTCTGAACTCGAGTTCAGAGTTATAGAGCCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016507.x-3607s1c1
Sequence:CCGGGCAGAACAGATGACCCTTGAACTCGAGTTCAAGGGTCATCTGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016507.x-5102s1c1
Sequence:CCGGCCATTGAGCATCTTGAACATACTCGAGTATGTTCAAGATGCTCAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_016507.x-1552s1c1
Sequence:CCGGGCACTGAAAGAGGAGATTGTTCTCGAGAACAATCTCCTCTTTCAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016507.x-3441s1c1
Sequence:CCGGGCTGCTTAACATCCACTCCAACTCGAGTTGGAGTGGATGTTAAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016507.1-455s1c1
Sequence:CCGGGATCGATGAAGGACCGGATATCTCGAGATATCCGGTCCTTCATCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016507.1-1100s1c1
Sequence:CCGGGAAGTAGAAGTCCTGCATATTCTCGAGAATATGCAGGACTTCTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016507
VALIDATED
CDK12 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 12
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-3219s21c1
Sequence:CCGGTTGGACTTGCTCGGCTCTATACTCGAGTATAGAGCCGAGCAAGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016507.2-5312s21c1
Sequence:CCGGAGAATATGGAGAGGATCATTACTCGAGTAATGATCCTCTCCATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-1163s21c1
Sequence:CCGGGGGCACAAAGACCGGAGTAAACTCGAGTTTACTCCGGTCTTTGTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016507.2-5213s21c1
Sequence:CCGGAGCAGGCGACTTACGAAATAACTCGAGTTATTTCGTAAGTCGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-1009s21c1
Sequence:CCGGATCGATGAAGGACCGGATATCCTCGAGGATATCCGGTCCTTCATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-1711s21c1
Sequence:CCGGCAGTTCACGCAGTCGTCATTCCTCGAGGAATGACGACTGCGTGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-2792s21c1
Sequence:CCGGGGAACCTATGGCCAAGTATATCTCGAGATATACTTGGCCATAGGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-2663s21c1
Sequence:CCGGCCACCTCAGCAACCATATAAACTCGAGTTTATATGGTTGCTGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-3014s21c1
Sequence:CCGGTACCTTGTATTTGAGTATATGCTCGAGCATATACTCAAATACAAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016507.2-7066s21c1
Sequence:CCGGCTATTGGTAAATCGCATTAAACTCGAGTTTAATGCGATTTACCAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-703s21c1
Sequence:CCGGATCGAAGCACAAGCGGCATAACTCGAGTTATGCCGCTTGTGCTTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016507.2-937s21c1
Sequence:CCGGGCGTTCCCGGGACTTACTAAACTCGAGTTTAGTAAGTCCCGGGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-3147s21c1
Sequence:CCGGATTTCCTGCATCGGGATATTACTCGAGTAATATCCCGATGCAGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016507.x-2674s1c1
Sequence:CCGGGCTCGGCTCTATAACTCTGAACTCGAGTTCAGAGTTATAGAGCCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016507.x-3607s1c1
Sequence:CCGGGCAGAACAGATGACCCTTGAACTCGAGTTCAAGGGTCATCTGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016507.x-5102s1c1
Sequence:CCGGCCATTGAGCATCTTGAACATACTCGAGTATGTTCAAGATGCTCAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_016507.x-1552s1c1
Sequence:CCGGGCACTGAAAGAGGAGATTGTTCTCGAGAACAATCTCCTCTTTCAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016507.x-3441s1c1
Sequence:CCGGGCTGCTTAACATCCACTCCAACTCGAGTTGGAGTGGATGTTAAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016507.1-455s1c1
Sequence:CCGGGATCGATGAAGGACCGGATATCTCGAGATATCCGGTCCTTCATCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016507.1-1100s1c1
Sequence:CCGGGAAGTAGAAGTCCTGCATATTCTCGAGAATATGCAGGACTTCTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016507
VALIDATED
CDK12 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 12
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-3219s21c1
Sequence:CCGGTTGGACTTGCTCGGCTCTATACTCGAGTATAGAGCCGAGCAAGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016507.2-5312s21c1
Sequence:CCGGAGAATATGGAGAGGATCATTACTCGAGTAATGATCCTCTCCATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-1163s21c1
Sequence:CCGGGGGCACAAAGACCGGAGTAAACTCGAGTTTACTCCGGTCTTTGTGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016507.2-5213s21c1
Sequence:CCGGAGCAGGCGACTTACGAAATAACTCGAGTTATTTCGTAAGTCGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-1009s21c1
Sequence:CCGGATCGATGAAGGACCGGATATCCTCGAGGATATCCGGTCCTTCATCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-1711s21c1
Sequence:CCGGCAGTTCACGCAGTCGTCATTCCTCGAGGAATGACGACTGCGTGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-2792s21c1
Sequence:CCGGGGAACCTATGGCCAAGTATATCTCGAGATATACTTGGCCATAGGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-2663s21c1
Sequence:CCGGCCACCTCAGCAACCATATAAACTCGAGTTTATATGGTTGCTGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-3014s21c1
Sequence:CCGGTACCTTGTATTTGAGTATATGCTCGAGCATATACTCAAATACAAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016507.2-7066s21c1
Sequence:CCGGCTATTGGTAAATCGCATTAAACTCGAGTTTAATGCGATTTACCAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-703s21c1
Sequence:CCGGATCGAAGCACAAGCGGCATAACTCGAGTTATGCCGCTTGTGCTTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016507.2-937s21c1
Sequence:CCGGGCGTTCCCGGGACTTACTAAACTCGAGTTTAGTAAGTCCCGGGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016507.2-3147s21c1
Sequence:CCGGATTTCCTGCATCGGGATATTACTCGAGTAATATCCCGATGCAGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016507.x-2674s1c1
Sequence:CCGGGCTCGGCTCTATAACTCTGAACTCGAGTTCAGAGTTATAGAGCCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016507.x-3607s1c1
Sequence:CCGGGCAGAACAGATGACCCTTGAACTCGAGTTCAAGGGTCATCTGTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016507.x-5102s1c1
Sequence:CCGGCCATTGAGCATCTTGAACATACTCGAGTATGTTCAAGATGCTCAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_016507.x-1552s1c1
Sequence:CCGGGCACTGAAAGAGGAGATTGTTCTCGAGAACAATCTCCTCTTTCAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016507.x-3441s1c1
Sequence:CCGGGCTGCTTAACATCCACTCCAACTCGAGTTGGAGTGGATGTTAAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016507.1-455s1c1
Sequence:CCGGGATCGATGAAGGACCGGATATCTCGAGATATCCGGTCCTTCATCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016507.1-1100s1c1
Sequence:CCGGGAAGTAGAAGTCCTGCATATTCTCGAGAATATGCAGGACTTCTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)