EMAIL THIS PAGE TO A FRIEND

CDK13

cyclin-dependent kinase 13

190 Gene Product Result for
Synonyms: CDC2L CDC2L5 CHED hCDK13
Gene ID:
Human(8621) Summary: The protein encoded by this gene is a member of the cyclin-dependent serine/threonine protein kinase family. Members of this family are well known for their essential roles as master switches in cell cycle control. The exact function of this protein has not yet been determined, but it may play a role in mRNA processing and may be involved in regulation of hematopoiesis. Alternatively spliced transcript variants have been described.[provided by RefSeq, Dec 2009]
Mouse(69562) cyclin-dependent kinase 13
Rat(306998) cyclin-dependent kinase 13
sheep(101119901) cyclin-dependent kinase 13
naked mole-rat(101725477) cyclin-dependent kinase 13
domestic guinea pig(100720065) cyclin-dependent kinase 13
Zebrafish(559027) cyclin-dependent kinase 13
dog(475874) cyclin-dependent kinase 13
chicken(420766) cyclin-dependent kinase 13
cow(511147) cyclin-dependent kinase 13
domestic cat(101098044) cyclin-dependent kinase 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003718 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_027118 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027118 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027118 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064771 MISSION® esiRNA esiRNA human CDC2L5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003718 Rosetta Predictions human pricing
NM_031267 Rosetta Predictions human pricing
XM_001053539 Rosetta Predictions rat pricing
XM_001053609 Rosetta Predictions rat pricing
XM_225404 Rosetta Predictions rat pricing
NM_001081058 Rosetta Predictions mouse pricing
NM_027118 Rosetta Predictions mouse pricing
XM_127221 Rosetta Predictions mouse pricing
XM_898093 Rosetta Predictions mouse pricing
XM_898114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186727 predicted 2869
2 SASI_Hs01_00186728 predicted 3059
3 SASI_Hs01_00186729 predicted 2549
4 SASI_Hs01_00186730 predicted 4288
5 SASI_Hs01_00186731 predicted 4650
6 SASI_Hs01_00186732 predicted 4128
7 SASI_Hs01_00186733 predicted 4259
8 SASI_Hs01_00186735 predicted 3905
9 SASI_Hs02_00336145 predicted 3035
10 SASI_Hs01_00186736 predicted 4392
11 SASI_Hs01_00186734 predicted 4352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122908 predicted 2870
2 SASI_Hs01_00122909 predicted 3059
3 SASI_Hs01_00122910 predicted 2551
4 SASI_Hs01_00122911 predicted 4103
5 SASI_Hs01_00122912 predicted 4474
6 SASI_Hs01_00122913 predicted 3942
7 SASI_Hs01_00122914 predicted 4082
8 SASI_Hs01_00122916 predicted 3724
9 SASI_Hs02_00358678 predicted 3034
10 SASI_Hs01_00122917 predicted 4216
11 SASI_Hs01_00122915 predicted 4171
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272683 predicted 3102
2 SASI_Rn02_00272684 predicted 4702
3 SASI_Rn02_00272685 predicted 2126
4 SASI_Rn02_00272686 predicted 3596
5 SASI_Rn02_00272687 predicted 3773
6 SASI_Rn02_00272688 predicted 3609
7 SASI_Rn02_00272689 predicted 4235
8 SASI_Rn02_00272690 predicted 4591
9 SASI_Rn02_00272691 predicted 3620
10 SASI_Rn02_00272692 predicted 2618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272931 predicted 3191
2 SASI_Rn02_00272932 predicted 4360
3 SASI_Rn02_00272933 predicted 4613
4 SASI_Rn02_00272934 predicted 2219
5 SASI_Rn02_00272935 predicted 3691
6 SASI_Rn02_00272936 predicted 4146
7 SASI_Rn02_00272937 predicted 4500
8 SASI_Rn02_00272938 predicted 4091
9 SASI_Rn02_00272939 predicted 3011
10 SASI_Rn02_00272940 predicted 2768
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382816 predicted 2904
2 SASI_Rn02_00382817 predicted 1923
3 SASI_Rn02_00382818 predicted 3392
4 SASI_Rn02_00382819 predicted 3575
5 SASI_Rn02_00382820 predicted 3401
6 SASI_Rn02_00382821 predicted 4026
7 SASI_Rn02_00382822 predicted 4384
8 SASI_Rn02_00382823 predicted 3421
9 SASI_Rn02_00382824 predicted 2418
10 SASI_Rn02_00382825 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294761 predicted 4422
2 SASI_Mm02_00294762 predicted 2720
3 SASI_Mm02_00294763 predicted 4815
4 SASI_Mm02_00294764 predicted 3086
5 SASI_Mm02_00294765 predicted 4656
6 SASI_Mm02_00294766 predicted 4282
7 SASI_Mm02_00294767 predicted 2843
8 SASI_Mm02_00294768 predicted 4069
9 SASI_Mm02_00294769 predicted 4340
10 SASI_Mm02_00294770 predicted 4157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331566 predicted 4238
2 SASI_Mm02_00331567 predicted 2729
3 SASI_Mm02_00331568 predicted 4636
4 SASI_Mm02_00331569 predicted 3083
5 SASI_Mm02_00331570 predicted 4471
6 SASI_Mm02_00331571 predicted 4102
7 SASI_Mm02_00331572 predicted 2850
8 SASI_Mm02_00331573 predicted 3886
9 SASI_Mm02_00331574 predicted 4162
10 SASI_Mm02_00331575 predicted 3979
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267430 predicted 4330
2 SASI_Mm01_00267431 predicted 3619
3 SASI_Mm01_00267432 predicted 2639
4 SASI_Mm01_00267433 predicted 3000
5 SASI_Mm01_00267434 predicted 4567
6 SASI_Mm01_00267435 predicted 4199
7 SASI_Mm01_00267436 predicted 2755
8 SASI_Mm01_00267437 predicted 3977
9 SASI_Mm01_00267438 predicted 3647
10 SASI_Mm01_00267439 predicted 4248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232355 predicted 2698
2 SASI_Mm01_00232356 predicted 1182
3 SASI_Mm01_00232357 predicted 2167
4 SASI_Mm01_00232358 predicted 3091
5 SASI_Mm01_00232359 predicted 1549
6 SASI_Mm01_00232360 predicted 2940
7 SASI_Mm01_00232361 predicted 2561
8 SASI_Mm01_00232362 predicted 1313
9 SASI_Mm01_00232363 predicted 2355
10 SASI_Mm01_00232364 predicted 2623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207728 predicted 4247
2 SASI_Mm01_00207729 predicted 2725
3 SASI_Mm01_00207730 predicted 4633
4 SASI_Mm01_00207731 predicted 3086
5 SASI_Mm01_00207732 predicted 4476
6 SASI_Mm01_00207733 predicted 4115
7 SASI_Mm01_00207734 predicted 2852
8 SASI_Mm01_00207735 predicted 3896
9 SASI_Mm01_00207736 predicted 4163
10 SASI_Mm01_00207737 predicted 2971
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003718
VALIDATED
CDK13 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 13
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_003718.2-1996s1c1
Sequence:CCGGGCTGATAGCTTACGAGGAAATCTCGAGATTTCCTCGTAAGCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003718.2-4225s1c1
Sequence:CCGGCGACGTAGTTTCATTGGAAATCTCGAGATTTCCAATGAAACTACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003718.2-4871s1c1
Sequence:CCGGCGATTGTACATCTTCACAAATCTCGAGATTTGTGAAGATGTACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003718.2-3944s1c1
Sequence:CCGGCTGAGGAAGATCTAGATTATCCTCGAGGATAATCTAGATCTTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003718.2-4216s1c1
Sequence:CCGGCCACTAGAACGACGTAGTTTCCTCGAGGAAACTACGTCGTTCTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003718.x-5160s1c1
Sequence:CCGGAGTGTTATTGTGAAAGGTGTACTCGAGTACACCTTTCACAATAACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003718.x-1981s1c1
Sequence:CCGGCCTGAAGATAAAGAAGCTGATCTCGAGATCAGCTTCTTTATCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003718.x-3040s1c1
Sequence:CCGGGCTGCGCTAGACTTATTTGATCTCGAGATCAAATAAGTCTAGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003718.x-3409s1c1
Sequence:CCGGGCAATTCTACTAAACCTACTACTCGAGTAGTAGGTTTAGTAGAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003718.x-2059s1c1
Sequence:CCGGCGATGTCTTCTTGCTGATTTACTCGAGTAAATCAGCAAGAAGACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003718.3-2146s21c1
Sequence:CCGGGCTGATAGCTTACGAGGAAATCTCGAGATTTCCTCGTAAGCTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003718.3-2209s21c1
Sequence:CCGGCGATGTCTTCTTGCTGATTTACTCGAGTAAATCAGCAAGAAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003718.3-4094s21c1
Sequence:CCGGCTGAGGAAGATCTAGATTATCCTCGAGGATAATCTAGATCTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003718.3-4375s21c1
Sequence:CCGGCGACGTAGTTTCATTGGAAATCTCGAGATTTCCAATGAAACTACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003718
VALIDATED
CDK13 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 13
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_003718.2-1996s1c1
Sequence:CCGGGCTGATAGCTTACGAGGAAATCTCGAGATTTCCTCGTAAGCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003718.2-4225s1c1
Sequence:CCGGCGACGTAGTTTCATTGGAAATCTCGAGATTTCCAATGAAACTACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003718.2-4871s1c1
Sequence:CCGGCGATTGTACATCTTCACAAATCTCGAGATTTGTGAAGATGTACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003718.2-3944s1c1
Sequence:CCGGCTGAGGAAGATCTAGATTATCCTCGAGGATAATCTAGATCTTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003718.2-4216s1c1
Sequence:CCGGCCACTAGAACGACGTAGTTTCCTCGAGGAAACTACGTCGTTCTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003718.x-5160s1c1
Sequence:CCGGAGTGTTATTGTGAAAGGTGTACTCGAGTACACCTTTCACAATAACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003718.x-1981s1c1
Sequence:CCGGCCTGAAGATAAAGAAGCTGATCTCGAGATCAGCTTCTTTATCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003718.x-3040s1c1
Sequence:CCGGGCTGCGCTAGACTTATTTGATCTCGAGATCAAATAAGTCTAGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003718.x-3409s1c1
Sequence:CCGGGCAATTCTACTAAACCTACTACTCGAGTAGTAGGTTTAGTAGAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003718.x-2059s1c1
Sequence:CCGGCGATGTCTTCTTGCTGATTTACTCGAGTAAATCAGCAAGAAGACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003718.3-2146s21c1
Sequence:CCGGGCTGATAGCTTACGAGGAAATCTCGAGATTTCCTCGTAAGCTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003718.3-2209s21c1
Sequence:CCGGCGATGTCTTCTTGCTGATTTACTCGAGTAAATCAGCAAGAAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003718.3-4094s21c1
Sequence:CCGGCTGAGGAAGATCTAGATTATCCTCGAGGATAATCTAGATCTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003718.3-4375s21c1
Sequence:CCGGCGACGTAGTTTCATTGGAAATCTCGAGATTTCCAATGAAACTACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003718
VALIDATED
CDK13 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 13
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_003718.2-1996s1c1
Sequence:CCGGGCTGATAGCTTACGAGGAAATCTCGAGATTTCCTCGTAAGCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003718.2-4225s1c1
Sequence:CCGGCGACGTAGTTTCATTGGAAATCTCGAGATTTCCAATGAAACTACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003718.2-4871s1c1
Sequence:CCGGCGATTGTACATCTTCACAAATCTCGAGATTTGTGAAGATGTACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_003718.2-3944s1c1
Sequence:CCGGCTGAGGAAGATCTAGATTATCCTCGAGGATAATCTAGATCTTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003718.2-4216s1c1
Sequence:CCGGCCACTAGAACGACGTAGTTTCCTCGAGGAAACTACGTCGTTCTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003718.x-5160s1c1
Sequence:CCGGAGTGTTATTGTGAAAGGTGTACTCGAGTACACCTTTCACAATAACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003718.x-1981s1c1
Sequence:CCGGCCTGAAGATAAAGAAGCTGATCTCGAGATCAGCTTCTTTATCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003718.x-3040s1c1
Sequence:CCGGGCTGCGCTAGACTTATTTGATCTCGAGATCAAATAAGTCTAGCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003718.x-3409s1c1
Sequence:CCGGGCAATTCTACTAAACCTACTACTCGAGTAGTAGGTTTAGTAGAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003718.x-2059s1c1
Sequence:CCGGCGATGTCTTCTTGCTGATTTACTCGAGTAAATCAGCAAGAAGACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003718.3-2146s21c1
Sequence:CCGGGCTGATAGCTTACGAGGAAATCTCGAGATTTCCTCGTAAGCTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003718.3-2209s21c1
Sequence:CCGGCGATGTCTTCTTGCTGATTTACTCGAGTAAATCAGCAAGAAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003718.3-4094s21c1
Sequence:CCGGCTGAGGAAGATCTAGATTATCCTCGAGGATAATCTAGATCTTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003718.3-4375s21c1
Sequence:CCGGCGACGTAGTTTCATTGGAAATCTCGAGATTTCCAATGAAACTACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127221
VALIDATED
CDK13 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127221.3-1624s1c1
Sequence:CCGGCCTGGATTATTGTCATAAGAACTCGAGTTCTTATGACAATAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127221.3-2407s1c1
Sequence:CCGGGCCGTTAAACCACAGTGAATTCTCGAGAATTCACTGTGGTTTAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127221.3-3350s1c1
Sequence:CCGGGCCAGTTCAGTAGCTGGATATCTCGAGATATCCAGCTACTGAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127221.3-1435s1c1
Sequence:CCGGCCAGAGTATCATCAATATGAACTCGAGTTCATATTGATGATACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127221.3-1756s1c1
Sequence:CCGGCCCATATACTAACAAGGTCATCTCGAGATGACCTTGTTAGTATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127221
VALIDATED
CDK13 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127221.3-1624s1c1
Sequence:CCGGCCTGGATTATTGTCATAAGAACTCGAGTTCTTATGACAATAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127221.3-2407s1c1
Sequence:CCGGGCCGTTAAACCACAGTGAATTCTCGAGAATTCACTGTGGTTTAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127221.3-3350s1c1
Sequence:CCGGGCCAGTTCAGTAGCTGGATATCTCGAGATATCCAGCTACTGAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127221.3-1435s1c1
Sequence:CCGGCCAGAGTATCATCAATATGAACTCGAGTTCATATTGATGATACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127221.3-1756s1c1
Sequence:CCGGCCCATATACTAACAAGGTCATCTCGAGATGACCTTGTTAGTATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127221
VALIDATED
CDK13 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127221.3-1624s1c1
Sequence:CCGGCCTGGATTATTGTCATAAGAACTCGAGTTCTTATGACAATAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127221.3-2407s1c1
Sequence:CCGGGCCGTTAAACCACAGTGAATTCTCGAGAATTCACTGTGGTTTAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127221.3-3350s1c1
Sequence:CCGGGCCAGTTCAGTAGCTGGATATCTCGAGATATCCAGCTACTGAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127221.3-1435s1c1
Sequence:CCGGCCAGAGTATCATCAATATGAACTCGAGTTCATATTGATGATACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127221.3-1756s1c1
Sequence:CCGGCCCATATACTAACAAGGTCATCTCGAGATGACCTTGTTAGTATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027118
VALIDATED
CDK13 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 13
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000368694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027118.1-3012s21c1
Sequence:CCGGTTTGGACTTGCTCGTTTATATCTCGAGATATAAACGAGCAAGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027118.1-1676s21c1
Sequence:CCGGCCGAAGCAGAAGCCCATATTCCTCGAGGAATATGGGCTTCTGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027118.1-3101s21c1
Sequence:CCGGCTTGGGAGAAGAACGATATACCTCGAGGTATATCGTTCTTCTCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027118.1-3214s21c1
Sequence:CCGGTAGAGCTAATAAGCCGTATATCTCGAGATATACGGCTTATTAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027118
VALIDATED
CDK13 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 13
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000368694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027118.1-3012s21c1
Sequence:CCGGTTTGGACTTGCTCGTTTATATCTCGAGATATAAACGAGCAAGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027118.1-1676s21c1
Sequence:CCGGCCGAAGCAGAAGCCCATATTCCTCGAGGAATATGGGCTTCTGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027118.1-3101s21c1
Sequence:CCGGCTTGGGAGAAGAACGATATACCTCGAGGTATATCGTTCTTCTCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027118.1-3214s21c1
Sequence:CCGGTAGAGCTAATAAGCCGTATATCTCGAGATATACGGCTTATTAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027118
VALIDATED
CDK13 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 13
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000368694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027118.1-3012s21c1
Sequence:CCGGTTTGGACTTGCTCGTTTATATCTCGAGATATAAACGAGCAAGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027118.1-1676s21c1
Sequence:CCGGCCGAAGCAGAAGCCCATATTCCTCGAGGAATATGGGCTTCTGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027118.1-3101s21c1
Sequence:CCGGCTTGGGAGAAGAACGATATACCTCGAGGTATATCGTTCTTCTCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027118.1-3214s21c1
Sequence:CCGGTAGAGCTAATAAGCCGTATATCTCGAGATATACGGCTTATTAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks