EMAIL THIS PAGE TO A FRIEND

CDK14

cyclin-dependent kinase 14

132 Gene Product Result for
Synonyms: PFTAIRE1 PFTK1
Gene ID:
Human(5218) Summary: PFTK1 is a member of the CDC2 (MIM 116940)-related protein kinase family (Yang and Chen, 2001 [PubMed 11313143]
Mouse(18647) cyclin-dependent kinase 14
Rat(362316) cyclin-dependent kinase 14
chicken(420546) cyclin-dependent kinase 14
Horse(100050770) cyclin-dependent kinase 14
dog(475223) cyclin-dependent kinase 14
cow(784403) cyclin-dependent kinase 14
domestic guinea pig(100715255) cyclin-dependent kinase 14
naked mole-rat(101697949) cyclin-dependent kinase 14
sheep(101109265) cyclin-dependent kinase 14
Domestic Rabbit(100328634) cyclin-dependent kinase 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012395 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012395 Rosetta Predictions human pricing
NM_001108617 Rosetta Predictions rat pricing
NM_011074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050762 predicted 1047
2 SASI_Hs01_00050764 predicted 823
3 SASI_Hs01_00050765 predicted 1226
4 SASI_Hs01_00050766 predicted 372
5 SASI_Hs01_00050767 predicted 205
6 SASI_Hs02_00344204 predicted 1095
7 SASI_Hs01_00050768 predicted 1219
8 SASI_Hs01_00050769 predicted 422
9 SASI_Hs01_00050770 predicted 514
10 SASI_Hs01_00050771 predicted 1218
11 SASI_Hs01_00050763 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240399 predicted 895
2 SASI_Rn02_00240400 predicted 823
3 SASI_Rn02_00240401 predicted 1169
4 SASI_Rn02_00240402 predicted 979
5 SASI_Rn02_00240403 predicted 697
6 SASI_Rn02_00240404 predicted 1227
7 SASI_Rn02_00240405 predicted 773
8 SASI_Rn02_00240406 predicted 1084
9 SASI_Rn02_00240407 predicted 1100
10 SASI_Rn02_00240408 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148855 predicted 1078
2 SASI_Mm01_00148857 predicted 285
3 SASI_Mm02_00319844 predicted 1200
4 SASI_Mm01_00148858 predicted 922
5 SASI_Mm02_00319845 predicted 1268
6 SASI_Mm01_00148859 predicted 1252
7 SASI_Mm01_00148860 predicted 1525
8 SASI_Mm01_00148861 predicted 1129
9 SASI_Mm01_00148862 predicted 1404
10 SASI_Mm01_00148863 predicted 552
11 SASI_Mm01_00148856 predicted 368
12 SASI_Mm01_00148864 predicted 421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011074
VALIDATED
CDK14 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 14
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-1410s21c1
Sequence:CCGGGCTGACTGATATGTCTTCTATCTCGAGATAGAAGACATATCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-1781s21c1
Sequence:CCGGCAAGAACTACGTGACGATTAACTCGAGTTAATCGTCACGTAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-861s21c1
Sequence:CCGGTTACATCCACCAGCGTTATATCTCGAGATATAACGCTGGTGGATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-1259s21c1
Sequence:CCGGGCCTTAGACAAGCATGGAATACTCGAGTATTCCATGCTTGTCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-1144s21c1
Sequence:CCGGGATCAACTTGAACGGATATTTCTCGAGAAATATCCGTTCAAGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011074.1-1369s1c1
Sequence:CCGGGCTGACTGATATGTCTTCTATCTCGAGATAGAAGACATATCAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011074.1-769s1c1
Sequence:CCGGCCATCCAGATAATGTGAAGTTCTCGAGAACTTCACATTATCTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011074.1-145s1c1
Sequence:CCGGGAGAACTTTGTCCGAGAGTTTCTCGAGAAACTCTCGGACAAAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011074.1-724s1c1
Sequence:CCGGGCACACTGATTTATGTCAGTACTCGAGTACTGACATAAATCAGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011074
VALIDATED
CDK14 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 14
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-1410s21c1
Sequence:CCGGGCTGACTGATATGTCTTCTATCTCGAGATAGAAGACATATCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-1781s21c1
Sequence:CCGGCAAGAACTACGTGACGATTAACTCGAGTTAATCGTCACGTAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-861s21c1
Sequence:CCGGTTACATCCACCAGCGTTATATCTCGAGATATAACGCTGGTGGATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-1259s21c1
Sequence:CCGGGCCTTAGACAAGCATGGAATACTCGAGTATTCCATGCTTGTCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-1144s21c1
Sequence:CCGGGATCAACTTGAACGGATATTTCTCGAGAAATATCCGTTCAAGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011074.1-1369s1c1
Sequence:CCGGGCTGACTGATATGTCTTCTATCTCGAGATAGAAGACATATCAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011074.1-769s1c1
Sequence:CCGGCCATCCAGATAATGTGAAGTTCTCGAGAACTTCACATTATCTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011074.1-145s1c1
Sequence:CCGGGAGAACTTTGTCCGAGAGTTTCTCGAGAAACTCTCGGACAAAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011074.1-724s1c1
Sequence:CCGGGCACACTGATTTATGTCAGTACTCGAGTACTGACATAAATCAGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011074
VALIDATED
CDK14 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 14
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-1410s21c1
Sequence:CCGGGCTGACTGATATGTCTTCTATCTCGAGATAGAAGACATATCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-1781s21c1
Sequence:CCGGCAAGAACTACGTGACGATTAACTCGAGTTAATCGTCACGTAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-861s21c1
Sequence:CCGGTTACATCCACCAGCGTTATATCTCGAGATATAACGCTGGTGGATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-1259s21c1
Sequence:CCGGGCCTTAGACAAGCATGGAATACTCGAGTATTCCATGCTTGTCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011074.2-1144s21c1
Sequence:CCGGGATCAACTTGAACGGATATTTCTCGAGAAATATCCGTTCAAGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011074.1-1369s1c1
Sequence:CCGGGCTGACTGATATGTCTTCTATCTCGAGATAGAAGACATATCAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011074.1-769s1c1
Sequence:CCGGCCATCCAGATAATGTGAAGTTCTCGAGAACTTCACATTATCTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011074.1-145s1c1
Sequence:CCGGGAGAACTTTGTCCGAGAGTTTCTCGAGAAACTCTCGGACAAAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011074.1-724s1c1
Sequence:CCGGGCACACTGATTTATGTCAGTACTCGAGTACTGACATAAATCAGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012395
CDK14 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 14
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.x-1166s1c1
Sequence:CCGGGAGTTCATTCTTTACCACATTCTCGAGAATGTGGTAAAGAATGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.x-1042s1c1
Sequence:CCGGGTAGGTTGCATCTTTGTTGAACTCGAGTTCAACAAAGATGCAACCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012395.x-3728s1c1
Sequence:CCGGCCACCCATACAGGAAATCCAACTCGAGTTGGATTTCCTGTATGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.x-456s1c1
Sequence:CCGGCTCGCCAACAAGTCCCAAATTCTCGAGAATTTGGGACTTGTTGGCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.x-416s1c1
Sequence:CCGGGCAAAGAGTCACCTAAAGTTACTCGAGTAACTTTAGGTGACTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.2-1117s1c1
Sequence:CCGGGAACGAATATTTCTGGTTCTTCTCGAGAAGAACCAGAAATATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.2-679s1c1
Sequence:CCGGCATGACATCATCCATACCAAGCTCGAGCTTGGTATGGATGATGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.2-224s1c1
Sequence:CCGGCAAAGATGTCTACACGGAACTCTCGAGAGTTCCGTGTAGACATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012395.2-376s1c1
Sequence:CCGGGAGAACAATGCTTGCATTAACCTCGAGGTTAATGCAAGCATTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012395.2-4342s1c1
Sequence:CCGGCCCTAGGTTATGCGTCTATATCTCGAGATATAGACGCATAACCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012395.2-4472s1c1
Sequence:CCGGGCTGCATAATTGCGCATAACTCTCGAGAGTTATGCGCAATTATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012395
CDK14 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 14
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.x-1166s1c1
Sequence:CCGGGAGTTCATTCTTTACCACATTCTCGAGAATGTGGTAAAGAATGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.x-1042s1c1
Sequence:CCGGGTAGGTTGCATCTTTGTTGAACTCGAGTTCAACAAAGATGCAACCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012395.x-3728s1c1
Sequence:CCGGCCACCCATACAGGAAATCCAACTCGAGTTGGATTTCCTGTATGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.x-456s1c1
Sequence:CCGGCTCGCCAACAAGTCCCAAATTCTCGAGAATTTGGGACTTGTTGGCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.x-416s1c1
Sequence:CCGGGCAAAGAGTCACCTAAAGTTACTCGAGTAACTTTAGGTGACTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.2-1117s1c1
Sequence:CCGGGAACGAATATTTCTGGTTCTTCTCGAGAAGAACCAGAAATATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.2-679s1c1
Sequence:CCGGCATGACATCATCCATACCAAGCTCGAGCTTGGTATGGATGATGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.2-224s1c1
Sequence:CCGGCAAAGATGTCTACACGGAACTCTCGAGAGTTCCGTGTAGACATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012395.2-376s1c1
Sequence:CCGGGAGAACAATGCTTGCATTAACCTCGAGGTTAATGCAAGCATTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012395.2-4342s1c1
Sequence:CCGGCCCTAGGTTATGCGTCTATATCTCGAGATATAGACGCATAACCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012395.2-4472s1c1
Sequence:CCGGGCTGCATAATTGCGCATAACTCTCGAGAGTTATGCGCAATTATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012395
CDK14 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 14
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.x-1166s1c1
Sequence:CCGGGAGTTCATTCTTTACCACATTCTCGAGAATGTGGTAAAGAATGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.x-1042s1c1
Sequence:CCGGGTAGGTTGCATCTTTGTTGAACTCGAGTTCAACAAAGATGCAACCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012395.x-3728s1c1
Sequence:CCGGCCACCCATACAGGAAATCCAACTCGAGTTGGATTTCCTGTATGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.x-456s1c1
Sequence:CCGGCTCGCCAACAAGTCCCAAATTCTCGAGAATTTGGGACTTGTTGGCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.x-416s1c1
Sequence:CCGGGCAAAGAGTCACCTAAAGTTACTCGAGTAACTTTAGGTGACTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.2-1117s1c1
Sequence:CCGGGAACGAATATTTCTGGTTCTTCTCGAGAAGAACCAGAAATATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.2-679s1c1
Sequence:CCGGCATGACATCATCCATACCAAGCTCGAGCTTGGTATGGATGATGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012395.2-224s1c1
Sequence:CCGGCAAAGATGTCTACACGGAACTCTCGAGAGTTCCGTGTAGACATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012395.2-376s1c1
Sequence:CCGGGAGAACAATGCTTGCATTAACCTCGAGGTTAATGCAAGCATTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012395.2-4342s1c1
Sequence:CCGGCCCTAGGTTATGCGTCTATATCTCGAGATATAGACGCATAACCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012395.2-4472s1c1
Sequence:CCGGGCTGCATAATTGCGCATAACTCTCGAGAGTTATGCGCAATTATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks