EMAIL THIS PAGE TO A FRIEND

CDK15

cyclin-dependent kinase 15

111 Gene Product Result for
Synonyms: ALS2CR7 PFTAIRE2 PFTK2
Gene ID:
Mouse(271697) cyclin-dependent kinase 15
sheep(101109860) cyclin-dependent kinase 15
Domestic Rabbit(100347484) cyclin-dependent kinase 15
naked mole-rat(101704695) cyclin-dependent kinase 15
domestic guinea pig(100719715) cyclin-dependent kinase 15
Zebrafish(791619) cyclin-dependent kinase 15
chicken(424086) cyclin-dependent kinase 15
dog(478873) cyclin-dependent kinase 15
Horse(100066274) cyclin-dependent kinase 15
cow(616118) cyclin-dependent kinase 15
domestic cat(101095120) cyclin-dependent kinase 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139158 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_194683 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_194683 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_194683 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_990659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_990659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_990659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136351 MISSION® esiRNA esiRNA human ALS2CR7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139158 Rosetta Predictions human pricing
XM_001475264 Rosetta Predictions mouse pricing
XM_990659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021704 predicted 1275
2 SASI_Hs01_00021705 predicted 374
3 SASI_Hs01_00021706 predicted 317
4 SASI_Hs01_00021707 predicted 366
5 SASI_Hs01_00021708 predicted 309
6 SASI_Hs01_00021709 predicted 419
7 SASI_Hs01_00021710 predicted 392
8 SASI_Hs01_00021711 predicted 949
9 SASI_Hs02_00364166 predicted 601
10 SASI_Hs01_00021712 predicted 930
11 SASI_Hs01_00021713 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00381273 predicted 506
2 SASI_Mm02_00381274 predicted 1083
3 SASI_Mm02_00381275 predicted 387
4 SASI_Mm02_00381276 predicted 532
5 SASI_Mm02_00381277 predicted 428
6 SASI_Mm02_00381278 predicted 523
7 SASI_Mm02_00381279 predicted 1067
8 SASI_Mm02_00381280 predicted 1304
9 SASI_Mm02_00381281 predicted 881
10 SASI_Mm02_00381282 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00450350 predicted 1085
2 SASI_Mm02_00450351 predicted 806
3 SASI_Mm02_00450352 predicted 1198
4 SASI_Mm01_00215680 predicted 858
5 SASI_Mm02_00450353 predicted 829
6 SASI_Mm02_00450354 predicted 734
7 SASI_Mm01_00215682 predicted 943
8 SASI_Mm02_00450355 predicted 1065
9 SASI_Mm01_00215686 predicted 1222
10 SASI_Mm01_00215687 predicted 880
11 SASI_Mm01_00215679 predicted 1005
12 SASI_Mm01_00215681 predicted 1294
13 SASI_Mm01_00215683 predicted 1316
14 SASI_Mm01_00215684 predicted 1311
15 SASI_Mm01_00215685 predicted 1272
16 SASI_Mm01_00215688 predicted 1196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139158
CDK15 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.1-770s1c1
Sequence:CCGGGCCACTGAATATTCCTCTGAGCTCGAGCTCAGAGGAATATTCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139158.1-1329s1c1
Sequence:CCGGGCTTACTAAGAAGCTTCAAATCTCGAGATTTGAAGCTTCTTAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.1-1088s1c1
Sequence:CCGGGAAGCACTTGTTCATGATTATCTCGAGATAATCATGAACAAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.1-531s1c1
Sequence:CCGGGAGGGCTTCATCCTCATAATGCTCGAGCATTATGAGGATGAAGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.1-1166s1c1
Sequence:CCGGGTTTCAGGAGTGAGGCTAAAGCTCGAGCTTTAGCCTCACTCCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.x-941s1c1
Sequence:CCGGCTACCTAACTACAATCCAGAACTCGAGTTCTGGATTGTAGTTAGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139158.x-1345s1c1
Sequence:CCGGCAAATCTAACTCCATACTGAACTCGAGTTCAGTATGGAGTTAGATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.x-314s1c1
Sequence:CCGGAGCAGAATAAATGGACAACTACTCGAGTAGTTGTCCATTTATTCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.x-283s1c1
Sequence:CCGGAGGCTCTTATGCGACAGTTTACTCGAGTAAACTGTCGCATAAGAGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139158
CDK15 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.1-770s1c1
Sequence:CCGGGCCACTGAATATTCCTCTGAGCTCGAGCTCAGAGGAATATTCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139158.1-1329s1c1
Sequence:CCGGGCTTACTAAGAAGCTTCAAATCTCGAGATTTGAAGCTTCTTAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.1-1088s1c1
Sequence:CCGGGAAGCACTTGTTCATGATTATCTCGAGATAATCATGAACAAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.1-531s1c1
Sequence:CCGGGAGGGCTTCATCCTCATAATGCTCGAGCATTATGAGGATGAAGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.1-1166s1c1
Sequence:CCGGGTTTCAGGAGTGAGGCTAAAGCTCGAGCTTTAGCCTCACTCCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.x-941s1c1
Sequence:CCGGCTACCTAACTACAATCCAGAACTCGAGTTCTGGATTGTAGTTAGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139158.x-1345s1c1
Sequence:CCGGCAAATCTAACTCCATACTGAACTCGAGTTCAGTATGGAGTTAGATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.x-314s1c1
Sequence:CCGGAGCAGAATAAATGGACAACTACTCGAGTAGTTGTCCATTTATTCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.x-283s1c1
Sequence:CCGGAGGCTCTTATGCGACAGTTTACTCGAGTAAACTGTCGCATAAGAGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139158
CDK15 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.1-770s1c1
Sequence:CCGGGCCACTGAATATTCCTCTGAGCTCGAGCTCAGAGGAATATTCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139158.1-1329s1c1
Sequence:CCGGGCTTACTAAGAAGCTTCAAATCTCGAGATTTGAAGCTTCTTAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.1-1088s1c1
Sequence:CCGGGAAGCACTTGTTCATGATTATCTCGAGATAATCATGAACAAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.1-531s1c1
Sequence:CCGGGAGGGCTTCATCCTCATAATGCTCGAGCATTATGAGGATGAAGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.1-1166s1c1
Sequence:CCGGGTTTCAGGAGTGAGGCTAAAGCTCGAGCTTTAGCCTCACTCCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.x-941s1c1
Sequence:CCGGCTACCTAACTACAATCCAGAACTCGAGTTCTGGATTGTAGTTAGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139158.x-1345s1c1
Sequence:CCGGCAAATCTAACTCCATACTGAACTCGAGTTCAGTATGGAGTTAGATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.x-314s1c1
Sequence:CCGGAGCAGAATAAATGGACAACTACTCGAGTAGTTGTCCATTTATTCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139158.x-283s1c1
Sequence:CCGGAGGCTCTTATGCGACAGTTTACTCGAGTAAACTGTCGCATAAGAGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_194683
CDK15 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-187s1c1
Sequence:CCGGGCCCAGAAGTTGAAGAGTAAACTCGAGTTTACTCTTCAACTTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-706s1c1
Sequence:CCGGGCCAATATTGTCCTCTTGCATCTCGAGATGCAAGAGGACAATATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-115s1c1
Sequence:CCGGGCTGTATTCGAGCTAACAGAACTCGAGTTCTGTTAGCTCGAATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-1222s1c1
Sequence:CCGGCTGCCTAACTACAATCCAGAACTCGAGTTCTGGATTGTAGTTAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-213s1c1
Sequence:CCGGCCGGAGTAACAGTGATTCTTTCTCGAGAAAGAATCACTGTTACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_194683
CDK15 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-187s1c1
Sequence:CCGGGCCCAGAAGTTGAAGAGTAAACTCGAGTTTACTCTTCAACTTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-706s1c1
Sequence:CCGGGCCAATATTGTCCTCTTGCATCTCGAGATGCAAGAGGACAATATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-115s1c1
Sequence:CCGGGCTGTATTCGAGCTAACAGAACTCGAGTTCTGTTAGCTCGAATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-1222s1c1
Sequence:CCGGCTGCCTAACTACAATCCAGAACTCGAGTTCTGGATTGTAGTTAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-213s1c1
Sequence:CCGGCCGGAGTAACAGTGATTCTTTCTCGAGAAAGAATCACTGTTACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_194683
CDK15 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-187s1c1
Sequence:CCGGGCCCAGAAGTTGAAGAGTAAACTCGAGTTTACTCTTCAACTTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-706s1c1
Sequence:CCGGGCCAATATTGTCCTCTTGCATCTCGAGATGCAAGAGGACAATATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-115s1c1
Sequence:CCGGGCTGTATTCGAGCTAACAGAACTCGAGTTCTGTTAGCTCGAATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-1222s1c1
Sequence:CCGGCTGCCTAACTACAATCCAGAACTCGAGTTCTGGATTGTAGTTAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194683.2-213s1c1
Sequence:CCGGCCGGAGTAACAGTGATTCTTTCTCGAGAAAGAATCACTGTTACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_990659
CDK15 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 15
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000368002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_990659.1-1415s21c1
Sequence:CCGGACGAAGCTTCGTGCCCTATTTCTCGAGAAATAGGGCACGAAGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_990659.1-525s21c1
Sequence:CCGGGCTTGAAGCATGCCAATATTGCTCGAGCAATATTGGCATGCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_990659.1-575s21c1
Sequence:CCGGGAGACTCTGACATTCGTATTTCTCGAGAAATACGAATGTCAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_990659
CDK15 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 15
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000368002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_990659.1-1415s21c1
Sequence:CCGGACGAAGCTTCGTGCCCTATTTCTCGAGAAATAGGGCACGAAGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_990659.1-525s21c1
Sequence:CCGGGCTTGAAGCATGCCAATATTGCTCGAGCAATATTGGCATGCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_990659.1-575s21c1
Sequence:CCGGGAGACTCTGACATTCGTATTTCTCGAGAAATACGAATGTCAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_990659
CDK15 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 15
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000368002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_990659.1-1415s21c1
Sequence:CCGGACGAAGCTTCGTGCCCTATTTCTCGAGAAATAGGGCACGAAGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_990659.1-525s21c1
Sequence:CCGGGCTTGAAGCATGCCAATATTGCTCGAGCAATATTGGCATGCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_990659.1-575s21c1
Sequence:CCGGGAGACTCTGACATTCGTATTTCTCGAGAAATACGAATGTCAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks