EMAIL THIS PAGE TO A FRIEND

CDK17

cyclin-dependent kinase 17

188 Gene Product Result for
Synonyms: PCTAIRE2 PCTK2
UniProtKB ID: Q00537, A8K1U6, B2RCQ2, Q8NEB8
Gene ID:
Human(5128) Summary: The protein encoded by this gene belongs to the cdc2/cdkx subfamily of the ser/thr family of protein kinases. It has similarity to a rat protein that is thought to play a role in terminally differentiated neurons. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jul 2010]
Mouse(237459) cyclin-dependent kinase 17
Rat(314743) cyclin-dependent kinase 17
sheep(101122426) cyclin-dependent kinase 17
Domestic Rabbit(100349141) cyclin-dependent kinase 17
naked mole-rat(101696844) cyclin-dependent kinase 17
domestic guinea pig(100722843) cyclin-dependent kinase 17
chicken(417920) cyclin-dependent kinase 17
domestic cat(101084463) cyclin-dependent kinase 17
cow(539655) cyclin-dependent kinase 17
Horse(100065667) cyclin-dependent kinase 17
dog(482614) cyclin-dependent kinase 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002595 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146239 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146239 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146239 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002595 siRNAs that have been validated in the lab human pricing
NM_001108082 Rosetta Predictions rat pricing
NM_146239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002595 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000031 validated 563
1 SASI_WI_00000032 validated 2698
2 SASI_Hs01_00154221 predicted 1081
3 SASI_Hs02_00334100 predicted 1255
4 SASI_Hs01_00154222 predicted 755
5 SASI_Hs01_00154223 predicted 979
6 SASI_Hs01_00154224 predicted 903
7 SASI_Hs01_00154226 predicted 1669
8 SASI_Hs01_00154227 predicted 1519
9 SASI_Hs01_00154228 predicted 1275
10 SASI_Hs01_00154229 predicted 1333
11 SASI_Hs01_00154230 predicted 662
12 SASI_Hs01_00154225 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235174 predicted 1800
2 SASI_Rn02_00235175 predicted 1080
3 SASI_Rn02_00235176 predicted 1558
4 SASI_Rn02_00235177 predicted 1697
5 SASI_Rn02_00235178 predicted 1541
6 SASI_Rn02_00235179 predicted 963
7 SASI_Rn02_00235180 predicted 635
8 SASI_Rn02_00235181 predicted 434
9 SASI_Rn02_00235182 predicted 1875
10 SASI_Rn02_00235183 predicted 1592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068415 predicted 1684
2 SASI_Mm01_00068417 predicted 949
3 SASI_Mm02_00341957 predicted 628
4 SASI_Mm02_00341958 predicted 956
5 SASI_Mm01_00068418 predicted 753
6 SASI_Mm01_00068419 predicted 1530
7 SASI_Mm01_00068420 predicted 1426
8 SASI_Mm01_00068421 predicted 1543
9 SASI_Mm01_00068422 predicted 1746
10 SASI_Mm02_00341959 predicted 1535
11 SASI_Mm01_00068416 predicted 1355
12 SASI_Mm01_00068423 predicted 924
13 SASI_Mm01_00068424 predicted 1133
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002595
VALIDATED
CDK17 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 17
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002595.2-3881s1c1
Sequence:CCGGGCCAATCATTTGCTTAGTAATCTCGAGATTACTAAGCAAATGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002595.2-1939s1c1
Sequence:CCGGCCAGAAAGTGTATCAATATTCCTCGAGGAATATTGATACACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002595.2-2300s1c1
Sequence:CCGGCAGCTATTGATGTAACTATAGCTCGAGCTATAGTTACATCAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-1820s1c1
Sequence:CCGGCTGAAGGAATTGAGTTGATAACTCGAGTTATCAACTCAATTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002595.2-1897s1c1
Sequence:CCGGCATGTGTACTTTCGAAGTCTGCTCGAGCAGACTTCGAAAGTACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002595.2-544s1c1
Sequence:CCGGGATGAATCATTGTCTGAATTGCTCGAGCAATTCAGACAATGATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-1888s1c1
Sequence:CCGGGCCATGAAACATGTGTACTTTCTCGAGAAAGTACACATGTTTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-663s1c1
Sequence:CCGGCCACCAGTACACAGGATCTTTCTCGAGAAAGATCCTGTGTACTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006241    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002595.2-2366s1c1
Sequence:CCGGGCGGAATCATTGCTGCTAAATCTCGAGATTTAGCAGCAATGATTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-972s1c1
Sequence:CCGGGCAGATAAACAGTCCACCATTCTCGAGAATGGTGGACTGTTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-892s1c1
Sequence:CCGGCGGATCTCAATGGAGGATTTACTCGAGTAAATCCTCCATTGAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002595.2-2462s21c1
Sequence:GTACCGGTCTGTTTCTCCTCACGAATTGCTCGAGCAATTCGTGAGGAGAAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002595.2-544s21c1
Sequence:CCGGGATGAATCATTGTCTGAATTGCTCGAGCAATTCAGACAATGATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002595.2-663s21c1
Sequence:CCGGCCACCAGTACACAGGATCTTTCTCGAGAAAGATCCTGTGTACTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002595.2-1939s21c1
Sequence:CCGGCCAGAAAGTGTATCAATATTCCTCGAGGAATATTGATACACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002595.2-1820s21c1
Sequence:CCGGCTGAAGGAATTGAGTTGATAACTCGAGTTATCAACTCAATTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002595.2-2366s21c1
Sequence:CCGGGCGGAATCATTGCTGCTAAATCTCGAGATTTAGCAGCAATGATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002595.2-2309s21c1
Sequence:GTACCGGATGTAACTATAGCTGCAATTTCTCGAGAAATTGCAGCTATAGTTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002595.2-2116s21c1
Sequence:GTACCGGTCAGAACTGAAGGCAATTATTCTCGAGAATAATTGCCTTCAGTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002595
VALIDATED
CDK17 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 17
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002595.2-3881s1c1
Sequence:CCGGGCCAATCATTTGCTTAGTAATCTCGAGATTACTAAGCAAATGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002595.2-1939s1c1
Sequence:CCGGCCAGAAAGTGTATCAATATTCCTCGAGGAATATTGATACACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002595.2-2300s1c1
Sequence:CCGGCAGCTATTGATGTAACTATAGCTCGAGCTATAGTTACATCAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-1820s1c1
Sequence:CCGGCTGAAGGAATTGAGTTGATAACTCGAGTTATCAACTCAATTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002595.2-1897s1c1
Sequence:CCGGCATGTGTACTTTCGAAGTCTGCTCGAGCAGACTTCGAAAGTACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002595.2-544s1c1
Sequence:CCGGGATGAATCATTGTCTGAATTGCTCGAGCAATTCAGACAATGATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-1888s1c1
Sequence:CCGGGCCATGAAACATGTGTACTTTCTCGAGAAAGTACACATGTTTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-663s1c1
Sequence:CCGGCCACCAGTACACAGGATCTTTCTCGAGAAAGATCCTGTGTACTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006241    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002595.2-2366s1c1
Sequence:CCGGGCGGAATCATTGCTGCTAAATCTCGAGATTTAGCAGCAATGATTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-972s1c1
Sequence:CCGGGCAGATAAACAGTCCACCATTCTCGAGAATGGTGGACTGTTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-892s1c1
Sequence:CCGGCGGATCTCAATGGAGGATTTACTCGAGTAAATCCTCCATTGAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002595.2-2462s21c1
Sequence:GTACCGGTCTGTTTCTCCTCACGAATTGCTCGAGCAATTCGTGAGGAGAAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002595.2-544s21c1
Sequence:CCGGGATGAATCATTGTCTGAATTGCTCGAGCAATTCAGACAATGATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002595.2-663s21c1
Sequence:CCGGCCACCAGTACACAGGATCTTTCTCGAGAAAGATCCTGTGTACTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002595.2-1939s21c1
Sequence:CCGGCCAGAAAGTGTATCAATATTCCTCGAGGAATATTGATACACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002595.2-1820s21c1
Sequence:CCGGCTGAAGGAATTGAGTTGATAACTCGAGTTATCAACTCAATTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002595.2-2366s21c1
Sequence:CCGGGCGGAATCATTGCTGCTAAATCTCGAGATTTAGCAGCAATGATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002595.2-2309s21c1
Sequence:GTACCGGATGTAACTATAGCTGCAATTTCTCGAGAAATTGCAGCTATAGTTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002595.2-2116s21c1
Sequence:GTACCGGTCAGAACTGAAGGCAATTATTCTCGAGAATAATTGCCTTCAGTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002595
VALIDATED
CDK17 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 17
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002595.2-3881s1c1
Sequence:CCGGGCCAATCATTTGCTTAGTAATCTCGAGATTACTAAGCAAATGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002595.2-1939s1c1
Sequence:CCGGCCAGAAAGTGTATCAATATTCCTCGAGGAATATTGATACACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002595.2-2300s1c1
Sequence:CCGGCAGCTATTGATGTAACTATAGCTCGAGCTATAGTTACATCAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-1820s1c1
Sequence:CCGGCTGAAGGAATTGAGTTGATAACTCGAGTTATCAACTCAATTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002595.2-1897s1c1
Sequence:CCGGCATGTGTACTTTCGAAGTCTGCTCGAGCAGACTTCGAAAGTACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002595.2-544s1c1
Sequence:CCGGGATGAATCATTGTCTGAATTGCTCGAGCAATTCAGACAATGATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-1888s1c1
Sequence:CCGGGCCATGAAACATGTGTACTTTCTCGAGAAAGTACACATGTTTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-663s1c1
Sequence:CCGGCCACCAGTACACAGGATCTTTCTCGAGAAAGATCCTGTGTACTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006241    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002595.2-2366s1c1
Sequence:CCGGGCGGAATCATTGCTGCTAAATCTCGAGATTTAGCAGCAATGATTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-972s1c1
Sequence:CCGGGCAGATAAACAGTCCACCATTCTCGAGAATGGTGGACTGTTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002595.2-892s1c1
Sequence:CCGGCGGATCTCAATGGAGGATTTACTCGAGTAAATCCTCCATTGAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002595.2-2462s21c1
Sequence:GTACCGGTCTGTTTCTCCTCACGAATTGCTCGAGCAATTCGTGAGGAGAAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002595.2-544s21c1
Sequence:CCGGGATGAATCATTGTCTGAATTGCTCGAGCAATTCAGACAATGATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002595.2-663s21c1
Sequence:CCGGCCACCAGTACACAGGATCTTTCTCGAGAAAGATCCTGTGTACTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002595.2-1939s21c1
Sequence:CCGGCCAGAAAGTGTATCAATATTCCTCGAGGAATATTGATACACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002595.2-1820s21c1
Sequence:CCGGCTGAAGGAATTGAGTTGATAACTCGAGTTATCAACTCAATTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002595.2-2366s21c1
Sequence:CCGGGCGGAATCATTGCTGCTAAATCTCGAGATTTAGCAGCAATGATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002595.2-2309s21c1
Sequence:GTACCGGATGTAACTATAGCTGCAATTTCTCGAGAAATTGCAGCTATAGTTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002595.2-2116s21c1
Sequence:GTACCGGTCAGAACTGAAGGCAATTATTCTCGAGAATAATTGCCTTCAGTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146239
CDK17 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 17
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-1220s1c1
Sequence:CCGGCCAGGTTAGATTCTGAAGGAACTCGAGTTCCTTCAGAATCTAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-346s1c1
Sequence:CCGGGCAGACATCAGGATACCTGATCTCGAGATCAGGTATCCTGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-1141s1c1
Sequence:CCGGCCAGGTGTTTCTTCAAATGATCTCGAGATCATTTGAAGAAACACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-281s1c1
Sequence:CCGGGCCTCAGAAATCGTATACATACTCGAGTATGTATACGATTTCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-922s1c1
Sequence:CCGGCCCACAAAGACCTACTCAAATCTCGAGATTTGAGTAGGTCTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146239.2-1801s21c1
Sequence:CCGGTTGCCCGAGAGCGTATCAATACTCGAGTATTGATACGCTCTCGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146239.2-1043s21c1
Sequence:CCGGGTGCACCCTGTACAGCTATAACTCGAGTTATAGCTGTACAGGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146239.2-2160s21c1
Sequence:CCGGAGTAGGTTACAGCTATCAATGCTCGAGCATTGATAGCTGTAACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146239.2-1643s21c1
Sequence:CCGGACAAGCCACAACCTCTAATTACTCGAGTAATTAGAGGTTGTGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146239
CDK17 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 17
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-1220s1c1
Sequence:CCGGCCAGGTTAGATTCTGAAGGAACTCGAGTTCCTTCAGAATCTAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-346s1c1
Sequence:CCGGGCAGACATCAGGATACCTGATCTCGAGATCAGGTATCCTGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-1141s1c1
Sequence:CCGGCCAGGTGTTTCTTCAAATGATCTCGAGATCATTTGAAGAAACACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-281s1c1
Sequence:CCGGGCCTCAGAAATCGTATACATACTCGAGTATGTATACGATTTCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-922s1c1
Sequence:CCGGCCCACAAAGACCTACTCAAATCTCGAGATTTGAGTAGGTCTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146239.2-1801s21c1
Sequence:CCGGTTGCCCGAGAGCGTATCAATACTCGAGTATTGATACGCTCTCGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146239.2-1043s21c1
Sequence:CCGGGTGCACCCTGTACAGCTATAACTCGAGTTATAGCTGTACAGGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146239.2-2160s21c1
Sequence:CCGGAGTAGGTTACAGCTATCAATGCTCGAGCATTGATAGCTGTAACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146239.2-1643s21c1
Sequence:CCGGACAAGCCACAACCTCTAATTACTCGAGTAATTAGAGGTTGTGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146239
CDK17 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 17
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-1220s1c1
Sequence:CCGGCCAGGTTAGATTCTGAAGGAACTCGAGTTCCTTCAGAATCTAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-346s1c1
Sequence:CCGGGCAGACATCAGGATACCTGATCTCGAGATCAGGTATCCTGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-1141s1c1
Sequence:CCGGCCAGGTGTTTCTTCAAATGATCTCGAGATCATTTGAAGAAACACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-281s1c1
Sequence:CCGGGCCTCAGAAATCGTATACATACTCGAGTATGTATACGATTTCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146239.1-922s1c1
Sequence:CCGGCCCACAAAGACCTACTCAAATCTCGAGATTTGAGTAGGTCTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146239.2-1801s21c1
Sequence:CCGGTTGCCCGAGAGCGTATCAATACTCGAGTATTGATACGCTCTCGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146239.2-1043s21c1
Sequence:CCGGGTGCACCCTGTACAGCTATAACTCGAGTTATAGCTGTACAGGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146239.2-2160s21c1
Sequence:CCGGAGTAGGTTACAGCTATCAATGCTCGAGCATTGATAGCTGTAACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146239.2-1643s21c1
Sequence:CCGGACAAGCCACAACCTCTAATTACTCGAGTAATTAGAGGTTGTGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks