EMAIL THIS PAGE TO A FRIEND

CDK18

cyclin-dependent kinase 18

Synonyms: PCTAIRE PCTAIRE3 PCTK3
UniProtKB ID: Q07002, Q5VXQ2, Q6V3A2, Q6V3A3, Q96F90
Gene ID:
Mouse(18557) cyclin-dependent kinase 18
Rat(289019) cyclin-dependent kinase 18
cow(534048) cyclin-dependent kinase 18
dog(488573) cyclin-dependent kinase 18
domestic cat(101085853) cyclin-dependent kinase 18
domestic guinea pig(100719802) cyclin-dependent kinase 18
naked mole-rat(101706815) cyclin-dependent kinase 18
sheep(101110858) cyclin-dependent kinase 18
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002596 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002596 Rosetta Predictions human pricing
NM_212502 Rosetta Predictions human pricing
NM_212503 Rosetta Predictions human pricing
NM_001100506 Rosetta Predictions rat pricing
NM_008795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334101 predicted 892
2 SASI_Hs01_00015475 predicted 1584
3 SASI_Hs01_00015476 predicted 993
4 SASI_Hs01_00015477 predicted 959
5 SASI_Hs01_00015478 predicted 885
6 SASI_Hs01_00015479 predicted 790
7 SASI_Hs01_00015480 predicted 2201
8 SASI_Hs01_00015481 predicted 1053
9 SASI_Hs01_00015483 predicted 1123
10 SASI_Hs01_00015484 predicted 797
11 SASI_Hs01_00015482 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374212 predicted 809
2 SASI_Hs01_00216137 predicted 1501
3 SASI_Hs01_00216138 predicted 909
4 SASI_Hs01_00216139 predicted 879
5 SASI_Hs01_00216140 predicted 801
6 SASI_Hs01_00216141 predicted 709
7 SASI_Hs01_00216142 predicted 2122
8 SASI_Hs01_00216143 predicted 977
9 SASI_Hs01_00216145 predicted 1048
10 SASI_Hs01_00216146 predicted 708
11 SASI_Hs01_00216144 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374213 predicted 901
2 SASI_Hs01_00182960 predicted 1600
3 SASI_Hs01_00182961 predicted 1001
4 SASI_Hs01_00182962 predicted 973
5 SASI_Hs01_00182963 predicted 893
6 SASI_Hs01_00182964 predicted 802
7 SASI_Hs01_00182965 predicted 2213
8 SASI_Hs01_00182966 predicted 1068
9 SASI_Hs01_00182968 predicted 1138
10 SASI_Hs01_00182969 predicted 801
11 SASI_Hs01_00182967 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209914 predicted 1033
2 SASI_Rn02_00209915 predicted 797
3 SASI_Rn02_00209916 predicted 434
4 SASI_Rn02_00209917 predicted 636
5 SASI_Rn02_00209918 predicted 252
6 SASI_Rn02_00209919 predicted 332
7 SASI_Rn02_00209920 predicted 403
8 SASI_Rn02_00209921 predicted 1181
9 SASI_Rn02_00209922 predicted 443
10 SASI_Rn02_00209923 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030600 predicted 1095
2 SASI_Mm01_00030601 predicted 1514
3 SASI_Mm01_00030602 predicted 1699
4 SASI_Mm01_00030605 predicted 548
5 SASI_Mm01_00030606 predicted 306
6 SASI_Mm01_00030607 predicted 1104
7 SASI_Mm02_00314698 predicted 698
8 SASI_Mm01_00030609 predicted 1731
9 SASI_Mm02_00314699 predicted 817
10 SASI_Mm02_00314700 predicted 1101
11 SASI_Mm01_00030603 predicted 645
12 SASI_Mm01_00030604 predicted 750
13 SASI_Mm01_00030608 predicted 390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002596
VALIDATED
CDK18 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 18
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_002596.2-969s21c1
Sequence:GTACCGGACAGTGACCTGAAGCAGTATCCTCGAGGATACTGCTTCAGGTCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002596.2-589s21c1
Sequence:GTACCGGGCTCTCTCTGCCCATGGATATCTCGAGATATCCATGGGCAGAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002596.2-1014s21c1
Sequence:CCGGGCATGCACAACGTCAAGATTTCTCGAGAAATCTTGACGTTGTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002596.2-1760s21c1
Sequence:CCGGAGATCACATGGAGCACAAATTCTCGAGAATTTGTGCTCCATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002596.2-718s21c1
Sequence:CCGGGAAACTGGAAACATACGTGAACTCGAGTTCACGTATGTTTCCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002596.2-1510s21c1
Sequence:CCGGCAGCCTGCTCCTGTATGAATCCTCGAGGATTCATACAGGAGCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002596.2-886s21c1
Sequence:CCGGGAACCTGAAGCACGCCAATATCTCGAGATATTGGCGTGCTTCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002596.2-2042s21c1
Sequence:GTACCGGATGCACACGGATGACAGAATCCTCGAGGATTCTGTCATCCGTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002596.2-2161s21c1
Sequence:GTACCGGTGGAGCCCACACACGTTTCATCTCGAGATGAAACGTGTGTGGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002596.1-2507s1c1
Sequence:CCGGGCCTTAAATTGGCAGGTGGTACTCGAGTACCACCTGCCAATTTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.1-784s1c1
Sequence:CCGGGCGCAGCAAACTGACGGAGAACTCGAGTTCTCCGTCAGTTTGCTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.1-1177s1c1
Sequence:CCGGGCCCACAAAGACTTACTCCAACTCGAGTTGGAGTAAGTCTTTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.1-356s1c1
Sequence:CCGGCGCACTGAGACCATTGAAGAACTCGAGTTCTTCAATGGTCTCAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002596.1-718s1c1
Sequence:CCGGGAAACTGGAAACATACGTGAACTCGAGTTCACGTATGTTTCCAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.2-1003s1c1
Sequence:CCGGGAACCTCATGAGCATGCACAACTCGAGTTGTGCATGCTCATGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002596.2-1869s1c1
Sequence:CCGGCCACGGCTGTTTCTTCTTTGTCTCGAGACAAAGAAGAAACAGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.2-1351s1c1
Sequence:CCGGGCACCTCATCTTTCGCCTCCTCTCGAGAGGAGGCGAAAGATGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.2-331s1c1
Sequence:CCGGGCGCCGTTTCTCCCTGTCAGTCTCGAGACTGACAGGGAGAAACGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.2-729s1c1
Sequence:CCGGCATACGTGAAACTGGACAAACCTCGAGGTTTGTCCAGTTTCACGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002596
VALIDATED
CDK18 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 18
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_002596.2-969s21c1
Sequence:GTACCGGACAGTGACCTGAAGCAGTATCCTCGAGGATACTGCTTCAGGTCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002596.2-589s21c1
Sequence:GTACCGGGCTCTCTCTGCCCATGGATATCTCGAGATATCCATGGGCAGAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002596.2-1014s21c1
Sequence:CCGGGCATGCACAACGTCAAGATTTCTCGAGAAATCTTGACGTTGTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002596.2-1760s21c1
Sequence:CCGGAGATCACATGGAGCACAAATTCTCGAGAATTTGTGCTCCATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002596.2-718s21c1
Sequence:CCGGGAAACTGGAAACATACGTGAACTCGAGTTCACGTATGTTTCCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002596.2-1510s21c1
Sequence:CCGGCAGCCTGCTCCTGTATGAATCCTCGAGGATTCATACAGGAGCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002596.2-886s21c1
Sequence:CCGGGAACCTGAAGCACGCCAATATCTCGAGATATTGGCGTGCTTCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002596.2-2042s21c1
Sequence:GTACCGGATGCACACGGATGACAGAATCCTCGAGGATTCTGTCATCCGTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002596.2-2161s21c1
Sequence:GTACCGGTGGAGCCCACACACGTTTCATCTCGAGATGAAACGTGTGTGGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002596.1-2507s1c1
Sequence:CCGGGCCTTAAATTGGCAGGTGGTACTCGAGTACCACCTGCCAATTTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.1-784s1c1
Sequence:CCGGGCGCAGCAAACTGACGGAGAACTCGAGTTCTCCGTCAGTTTGCTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.1-1177s1c1
Sequence:CCGGGCCCACAAAGACTTACTCCAACTCGAGTTGGAGTAAGTCTTTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.1-356s1c1
Sequence:CCGGCGCACTGAGACCATTGAAGAACTCGAGTTCTTCAATGGTCTCAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002596.1-718s1c1
Sequence:CCGGGAAACTGGAAACATACGTGAACTCGAGTTCACGTATGTTTCCAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.2-1003s1c1
Sequence:CCGGGAACCTCATGAGCATGCACAACTCGAGTTGTGCATGCTCATGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002596.2-1869s1c1
Sequence:CCGGCCACGGCTGTTTCTTCTTTGTCTCGAGACAAAGAAGAAACAGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.2-1351s1c1
Sequence:CCGGGCACCTCATCTTTCGCCTCCTCTCGAGAGGAGGCGAAAGATGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.2-331s1c1
Sequence:CCGGGCGCCGTTTCTCCCTGTCAGTCTCGAGACTGACAGGGAGAAACGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.2-729s1c1
Sequence:CCGGCATACGTGAAACTGGACAAACCTCGAGGTTTGTCCAGTTTCACGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002596
VALIDATED
CDK18 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 18
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_002596.2-969s21c1
Sequence:GTACCGGACAGTGACCTGAAGCAGTATCCTCGAGGATACTGCTTCAGGTCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002596.2-589s21c1
Sequence:GTACCGGGCTCTCTCTGCCCATGGATATCTCGAGATATCCATGGGCAGAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002596.2-1014s21c1
Sequence:CCGGGCATGCACAACGTCAAGATTTCTCGAGAAATCTTGACGTTGTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002596.2-1760s21c1
Sequence:CCGGAGATCACATGGAGCACAAATTCTCGAGAATTTGTGCTCCATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002596.2-718s21c1
Sequence:CCGGGAAACTGGAAACATACGTGAACTCGAGTTCACGTATGTTTCCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002596.2-1510s21c1
Sequence:CCGGCAGCCTGCTCCTGTATGAATCCTCGAGGATTCATACAGGAGCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002596.2-886s21c1
Sequence:CCGGGAACCTGAAGCACGCCAATATCTCGAGATATTGGCGTGCTTCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002596.2-2042s21c1
Sequence:GTACCGGATGCACACGGATGACAGAATCCTCGAGGATTCTGTCATCCGTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002596.2-2161s21c1
Sequence:GTACCGGTGGAGCCCACACACGTTTCATCTCGAGATGAAACGTGTGTGGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002596.1-2507s1c1
Sequence:CCGGGCCTTAAATTGGCAGGTGGTACTCGAGTACCACCTGCCAATTTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.1-784s1c1
Sequence:CCGGGCGCAGCAAACTGACGGAGAACTCGAGTTCTCCGTCAGTTTGCTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.1-1177s1c1
Sequence:CCGGGCCCACAAAGACTTACTCCAACTCGAGTTGGAGTAAGTCTTTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.1-356s1c1
Sequence:CCGGCGCACTGAGACCATTGAAGAACTCGAGTTCTTCAATGGTCTCAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002596.1-718s1c1
Sequence:CCGGGAAACTGGAAACATACGTGAACTCGAGTTCACGTATGTTTCCAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.2-1003s1c1
Sequence:CCGGGAACCTCATGAGCATGCACAACTCGAGTTGTGCATGCTCATGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002596.2-1869s1c1
Sequence:CCGGCCACGGCTGTTTCTTCTTTGTCTCGAGACAAAGAAGAAACAGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.2-1351s1c1
Sequence:CCGGGCACCTCATCTTTCGCCTCCTCTCGAGAGGAGGCGAAAGATGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.2-331s1c1
Sequence:CCGGGCGCCGTTTCTCCCTGTCAGTCTCGAGACTGACAGGGAGAAACGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002596.2-729s1c1
Sequence:CCGGCATACGTGAAACTGGACAAACCTCGAGGTTTGTCCAGTTTCACGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008795
VALIDATED
CDK18 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008795.1-2065s1c1
Sequence:CCGGCCCTCTGAGAACGAGGAATATCTCGAGATATTCCTCGTTCTCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008795.1-966s1c1
Sequence:CCGGGCACAATGTCAAGATATTCATCTCGAGATGAATATCTTGACATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008795.1-833s1c1
Sequence:CCGGAGGACCTGAAACACGCCAATACTCGAGTATTGGCGTGTTTCAGGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008795.1-480s1c1
Sequence:CCGGGCAGTATCAACAACGGCAGAACTCGAGTTCTGCCGTTGTTGATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008795.1-1125s1c1
Sequence:CCGGGCCTACAAAGACCTATTCCAACTCGAGTTGGAATAGGTCTTTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008795
VALIDATED
CDK18 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008795.1-2065s1c1
Sequence:CCGGCCCTCTGAGAACGAGGAATATCTCGAGATATTCCTCGTTCTCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008795.1-966s1c1
Sequence:CCGGGCACAATGTCAAGATATTCATCTCGAGATGAATATCTTGACATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008795.1-833s1c1
Sequence:CCGGAGGACCTGAAACACGCCAATACTCGAGTATTGGCGTGTTTCAGGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008795.1-480s1c1
Sequence:CCGGGCAGTATCAACAACGGCAGAACTCGAGTTCTGCCGTTGTTGATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008795.1-1125s1c1
Sequence:CCGGGCCTACAAAGACCTATTCCAACTCGAGTTGGAATAGGTCTTTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008795
VALIDATED
CDK18 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008795.1-2065s1c1
Sequence:CCGGCCCTCTGAGAACGAGGAATATCTCGAGATATTCCTCGTTCTCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008795.1-966s1c1
Sequence:CCGGGCACAATGTCAAGATATTCATCTCGAGATGAATATCTTGACATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008795.1-833s1c1
Sequence:CCGGAGGACCTGAAACACGCCAATACTCGAGTATTGGCGTGTTTCAGGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008795.1-480s1c1
Sequence:CCGGGCAGTATCAACAACGGCAGAACTCGAGTTCTGCCGTTGTTGATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008795.1-1125s1c1
Sequence:CCGGGCCTACAAAGACCTATTCCAACTCGAGTTGGAATAGGTCTTTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks