EMAIL THIS PAGE TO A FRIEND

CDK19

cyclin-dependent kinase 19

279 Gene Product Result for
Synonyms: CDC2L6 CDK11 bA346C16.3
UniProtKB ID: Q9BWU1, Q5JQZ7, Q5JR00, Q8TC78, Q9UPX2
Gene ID:
Human(23097) Summary: This gene encodes a protein that is one of the components of the Mediator coactivator complex. The Mediator complex is a multiprotein complex required for transcriptional activation by DNA binding transcription factors of genes transcribed by RNA polymerase II. The protein encoded by this gene is similar to cyclin-dependent kinase 8 which can also be a component of the Mediator complex. [provided by RefSeq, Jul 2008]
Mouse(78334) cyclin-dependent kinase 19
Rat(309804) cyclin-dependent kinase 19
sheep(101111460) cyclin-dependent kinase 19
naked mole-rat(101708681) cyclin-dependent kinase 19
domestic guinea pig(100730615) cyclin-dependent kinase 19
Zebrafish(100149670) cyclin-dependent kinase 19
chicken(421756) cyclin-dependent kinase 19
cow(511802) cyclin-dependent kinase 19
Horse(100066791) cyclin-dependent kinase 19
domestic cat(101083850) cyclin-dependent kinase 19
dog(612317) cyclin-dependent kinase 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407176 Anti-CDC2L6 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1410403 Anti-CDC2L6 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4301196 Anti-CDK19 antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
HPA007053 ANTI-CDK19 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB1302333 ANTI-MOUSE CDK19 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB1409016 Monoclonal Anti-CDC2L6 antibody produced in mouse clone 2C6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409017 Monoclonal Anti-CDC2L6 antibody produced in mouse clone 8B6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404953 Monoclonal Anti-CDC2L6, (N-terminal) antibody produced in mouse clone 2F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1402550 Monoclonal Anti-CDC2L6, (N-terminal) antibody produced in mouse clone 3D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015076 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061571 MISSION® esiRNA esiRNA human CDC2L6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015076 Rosetta Predictions human pricing
NM_001107634 Rosetta Predictions rat pricing
NM_198164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108233 predicted 603
2 SASI_Hs01_00108234 predicted 338
3 SASI_Hs01_00108235 predicted 709
4 SASI_Hs01_00108237 predicted 796
5 SASI_Hs01_00108238 predicted 1626
6 SASI_Hs01_00108239 predicted 224
7 SASI_Hs01_00108240 predicted 696
8 SASI_Hs01_00108241 predicted 886
9 SASI_Hs01_00108242 predicted 443
10 SASI_Hs02_00346941 predicted 208
11 SASI_Hs01_00108236 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230765 predicted 998
2 SASI_Rn02_00230766 predicted 559
3 SASI_Rn02_00230767 predicted 1607
4 SASI_Rn02_00230768 predicted 410
5 SASI_Rn02_00230769 predicted 785
6 SASI_Rn02_00230770 predicted 1326
7 SASI_Rn02_00230771 predicted 557
8 SASI_Rn02_00230772 predicted 435
9 SASI_Rn02_00230773 predicted 405
10 SASI_Rn02_00230774 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184681 predicted 558
2 SASI_Mm01_00184682 predicted 936
3 SASI_Mm01_00184683 predicted 412
4 SASI_Mm01_00184684 predicted 971
5 SASI_Mm01_00184685 predicted 1585
6 SASI_Mm01_00184686 predicted 880
7 SASI_Mm01_00184688 predicted 776
8 SASI_Mm01_00184689 predicted 432
9 SASI_Mm01_00184690 predicted 863
10 SASI_Mm02_00350874 predicted 705
11 SASI_Mm01_00184687 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015076
VALIDATED
CDK19 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 19
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.3-938s1c1
Sequence:CCGGGCCAACAGTAGCCTCATAAAGCTCGAGCTTTATGAGGCTACTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.3-2127s1c1
Sequence:CCGGCGTTCGTATTTATCTAGTTTCCTCGAGGAAACTAGATAAATACGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.3-376s1c1
Sequence:CCGGGCATGACTTGTGGCATATTATCTCGAGATAATATGCCACAAGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015076.3-5803s1c1
Sequence:CCGGCTTTCTAAACTGCCTAGTTTGCTCGAGCAAACTAGGCAGTTTAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.x-367s1c1
Sequence:CCGGGCTTGTAGAGAGATTGCACTTCTCGAGAAGTGCAATCTCTCTACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015076.x-390s1c1
Sequence:CCGGGCGAGAATTGAAGCACCCTAACTCGAGTTAGGGTGCTTCAATTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015076.x-639s1c1
Sequence:CCGGACCAGCAAATATCCTAGTAATCTCGAGATTACTAGGATATTTGCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.x-1837s1c1
Sequence:CCGGAGGACTGATAGCTCTTCTTTACTCGAGTAAAGAAGAGCTATCAGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.x-985s1c1
Sequence:CCGGGATATTAGAAAGATGCCAGAACTCGAGTTCTGGCATCTTTCTAATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015076.3-350s21c1
Sequence:CCGGGTATGGCTGCTGTTTGATTATCTCGAGATAATCAAACAGCAGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015076.3-260s21c1
Sequence:CCGGGCTTGTAGAGAGATTGCACTTCTCGAGAAGTGCAATCTCTCTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015076
VALIDATED
CDK19 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 19
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.3-938s1c1
Sequence:CCGGGCCAACAGTAGCCTCATAAAGCTCGAGCTTTATGAGGCTACTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.3-2127s1c1
Sequence:CCGGCGTTCGTATTTATCTAGTTTCCTCGAGGAAACTAGATAAATACGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.3-376s1c1
Sequence:CCGGGCATGACTTGTGGCATATTATCTCGAGATAATATGCCACAAGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015076.3-5803s1c1
Sequence:CCGGCTTTCTAAACTGCCTAGTTTGCTCGAGCAAACTAGGCAGTTTAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.x-367s1c1
Sequence:CCGGGCTTGTAGAGAGATTGCACTTCTCGAGAAGTGCAATCTCTCTACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015076.x-390s1c1
Sequence:CCGGGCGAGAATTGAAGCACCCTAACTCGAGTTAGGGTGCTTCAATTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015076.x-639s1c1
Sequence:CCGGACCAGCAAATATCCTAGTAATCTCGAGATTACTAGGATATTTGCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.x-1837s1c1
Sequence:CCGGAGGACTGATAGCTCTTCTTTACTCGAGTAAAGAAGAGCTATCAGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.x-985s1c1
Sequence:CCGGGATATTAGAAAGATGCCAGAACTCGAGTTCTGGCATCTTTCTAATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015076.3-350s21c1
Sequence:CCGGGTATGGCTGCTGTTTGATTATCTCGAGATAATCAAACAGCAGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015076.3-260s21c1
Sequence:CCGGGCTTGTAGAGAGATTGCACTTCTCGAGAAGTGCAATCTCTCTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015076
VALIDATED
CDK19 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 19
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.3-938s1c1
Sequence:CCGGGCCAACAGTAGCCTCATAAAGCTCGAGCTTTATGAGGCTACTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.3-2127s1c1
Sequence:CCGGCGTTCGTATTTATCTAGTTTCCTCGAGGAAACTAGATAAATACGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.3-376s1c1
Sequence:CCGGGCATGACTTGTGGCATATTATCTCGAGATAATATGCCACAAGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015076.3-5803s1c1
Sequence:CCGGCTTTCTAAACTGCCTAGTTTGCTCGAGCAAACTAGGCAGTTTAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.x-367s1c1
Sequence:CCGGGCTTGTAGAGAGATTGCACTTCTCGAGAAGTGCAATCTCTCTACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015076.x-390s1c1
Sequence:CCGGGCGAGAATTGAAGCACCCTAACTCGAGTTAGGGTGCTTCAATTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015076.x-639s1c1
Sequence:CCGGACCAGCAAATATCCTAGTAATCTCGAGATTACTAGGATATTTGCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.x-1837s1c1
Sequence:CCGGAGGACTGATAGCTCTTCTTTACTCGAGTAAAGAAGAGCTATCAGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015076.x-985s1c1
Sequence:CCGGGATATTAGAAAGATGCCAGAACTCGAGTTCTGGCATCTTTCTAATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015076.3-350s21c1
Sequence:CCGGGTATGGCTGCTGTTTGATTATCTCGAGATAATCAAACAGCAGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015076.3-260s21c1
Sequence:CCGGGCTTGTAGAGAGATTGCACTTCTCGAGAAGTGCAATCTCTCTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198164
VALIDATED
CDK19 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 19
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198164.1-1144s1c1
Sequence:CCGGCCTGCCAACATTAGATGTGTTCTCGAGAACACATCTAATGTTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198164.1-1491s1c1
Sequence:CCGGCGTCGGATTATCAGCATTCCACTCGAGTGGAATGCTGATAATCCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198164.1-542s1c1
Sequence:CCGGCTGCTGTTTGACTATGCAGAACTCGAGTTCTGCATAGTCAAACAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198164.1-955s1c1
Sequence:CCGGCCCAACACTTCAGAAAGACTTCTCGAGAAGTCTTTCTGAAGTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198164.2-1479s21c1
Sequence:CCGGCCCGTTATGCCGTCGGATTATCTCGAGATAATCCGACGGCATAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198164.2-872s21c1
Sequence:CCGGTGATCAGTTAGATCGAATATTCTCGAGAATATTCGATCTAACTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198164.2-830s21c1
Sequence:CCGGCTGTCGTCAGGAGGATATAAACTCGAGTTTATATCCTCCTGACGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198164.2-624s21c1
Sequence:CCGGTTACCAAGATCCATGGTTAAACTCGAGTTTAACCATGGATCTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198164
VALIDATED
CDK19 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 19
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198164.1-1144s1c1
Sequence:CCGGCCTGCCAACATTAGATGTGTTCTCGAGAACACATCTAATGTTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198164.1-1491s1c1
Sequence:CCGGCGTCGGATTATCAGCATTCCACTCGAGTGGAATGCTGATAATCCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198164.1-542s1c1
Sequence:CCGGCTGCTGTTTGACTATGCAGAACTCGAGTTCTGCATAGTCAAACAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198164.1-955s1c1
Sequence:CCGGCCCAACACTTCAGAAAGACTTCTCGAGAAGTCTTTCTGAAGTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198164.2-1479s21c1
Sequence:CCGGCCCGTTATGCCGTCGGATTATCTCGAGATAATCCGACGGCATAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198164.2-872s21c1
Sequence:CCGGTGATCAGTTAGATCGAATATTCTCGAGAATATTCGATCTAACTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198164.2-830s21c1
Sequence:CCGGCTGTCGTCAGGAGGATATAAACTCGAGTTTATATCCTCCTGACGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198164.2-624s21c1
Sequence:CCGGTTACCAAGATCCATGGTTAAACTCGAGTTTAACCATGGATCTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198164
VALIDATED
CDK19 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 19
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198164.1-1144s1c1
Sequence:CCGGCCTGCCAACATTAGATGTGTTCTCGAGAACACATCTAATGTTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198164.1-1491s1c1
Sequence:CCGGCGTCGGATTATCAGCATTCCACTCGAGTGGAATGCTGATAATCCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198164.1-542s1c1
Sequence:CCGGCTGCTGTTTGACTATGCAGAACTCGAGTTCTGCATAGTCAAACAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198164.1-955s1c1
Sequence:CCGGCCCAACACTTCAGAAAGACTTCTCGAGAAGTCTTTCTGAAGTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198164.2-1479s21c1
Sequence:CCGGCCCGTTATGCCGTCGGATTATCTCGAGATAATCCGACGGCATAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198164.2-872s21c1
Sequence:CCGGTGATCAGTTAGATCGAATATTCTCGAGAATATTCGATCTAACTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198164.2-830s21c1
Sequence:CCGGCTGTCGTCAGGAGGATATAAACTCGAGTTTATATCCTCCTGACGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198164.2-624s21c1
Sequence:CCGGTTACCAAGATCCATGGTTAAACTCGAGTTTAACCATGGATCTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks