EMAIL THIS PAGE TO A FRIEND

CDK1

cyclin-dependent kinase 1

121 Gene Product Result for
Synonyms: CDC2 CDC28A P34CDC2
UniProtKB ID: P06493, A8K7C4, C9J497, O60764
Gene ID:
Human(983) Summary: The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with this protein and function as regulatory subunits. The kinase activity of this protein is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of this protein also play important regulatory roles in cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(12534) cyclin-dependent kinase 1
Rat(54237) cyclin-dependent kinase 1
Zebrafish(80973) cyclin-dependent kinase 1
chicken(396252) cyclin-dependent kinase 1
dog(488997) cyclin-dependent kinase 1
cow(281061) cyclin-dependent kinase 1
naked mole-rat(101717463) cyclin-dependent kinase 1
domestic guinea pig(100735946) cyclin-dependent kinase 1
Goat(100861361) cyclin-dependent kinase 1
sheep(100216432) cyclin-dependent kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300492 Anti-CDC2 (Ab-15) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300421 Anti-CDC2 (Ab-161) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, western blot pricing
SAB4300590 Anti-CDC2 (Ab-19) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB2100378 Anti-CDC2 (ab1) antibody produced in rabbit affinity isolated antibody rat, horse, mouse, rabbit, sheep, goat, yeast, Arabidopsis sp., human
western blot pricing
SAB2100379 Anti-CDC2 (ab2) antibody produced in rabbit affinity isolated antibody rabbit, yeast, sheep, human, rat, zebrafish, mouse, bovine, goat
western blot pricing
SAB2103891 Anti-CDC2 antibody produced in rabbit affinity isolated antibody canine, bovine, yeast, mouse, pig, sheep, human, goat, rat, rabbit
western blot pricing
SAB4500051 Anti-CDC2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4503707 Anti-CDC2 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB4503705 Anti-CDC2, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
C4607 Anti-Cdk1 (p34cdc2) antibody produced in rabbit whole antiserum rat (predicted), mouse, human (predicted)
immunoprecipitation, western blot pricing
HPA003387 Anti-CDK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
C0228 Anti-phospho-Cdc2 (Cdk1) (pTyr15) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunoprecipitation, western blot pricing
SAB4300111 Anti-phospho-CDC2 (pThr161) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4504358 Anti-phospho-CDC2 (pThr161) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300193 Anti-phospho-CDC2 (pTyr15) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4504359 Anti-phospho-CDC2 (pTyr15) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
C0231 Anti-phospho-Cdk1 (pThr14/pTyr15) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunoprecipitation, western blot pricing
WH0000983M1 Monoclonal Anti-CDC2 antibody produced in mouse clone 1A4-1A9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1400047 Monoclonal Anti-CDC2 antibody produced in mouse clone 1C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403652 Monoclonal Anti-CDC2, (C-terminal) antibody produced in mouse clone 8F1, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
P7962 Monoclonal Anti-PSTAIR antibody produced in mouse clone PSTAIR, ascites fluid Japanese quail, Xenopus, human, ciliates, carp, onion, amago salmon, mouse, monkey, goldfish, eel, lily, starfish
ELISA, immunoprecipitation, western blot pricing
PLA0287 Rabbit anti-CDK1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. pig, primate, chicken, sheep, dog, rabbit, human, bovine, guinea pig, turkey, goat
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001786 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB3241-25UL Anti-Cdc2 Antibody, phospho-specific (Tyr15) Use Anti-Cdc2 Antibody, phospho-specific (Tyr15) (Rabbit Polyclonal Antibody) validated in WB to detect Cdc2 also known as Cell Division Cycle 2, p34 Protein Kinase. pricing
AB3241 Anti-Cdc2 Antibody, phospho-specific (Tyr15) Use Anti-Cdc2 Antibody, phospho-specific (Tyr15) (Rabbit Polyclonal Antibody) validated in WB to detect Cdc2 also known as Cell Division Cycle 2, p34 Protein Kinase. pricing
MAB8878 Anti-Cdk1 Antibody, clone A17.1.1 Anti-Cdk1 Antibody, clone A17.1.1 is a Mouse Monoclonal Antibody for detection of Cdk1 also known as p34cdc2, CDC2 & has been validated in IF, IP, EA, WB, IHC(P). pricing
ABE1403 Anti-Cdk1/cdc2 Antibody C-term This Anti-Cdk1/cdc2 Antibody C-term is validated for use in Western Blotting and Immunohistochemistry and Immunoprecipitation for the detection of Cdk1/cdc2 C-term. pricing
06-966 Anti-CDK1/CDC2 Antibody (C-Term) Detect Cdk1/Cdc2 with Anti-Cdk1/Cdc2 Antibody, CT (Rabbit Polyclonal Antibody), that has been shown to work in IP & WB. pricing
06-923 Anti-Cdk1/Cdc2 (PSTAIR) Antibody Anti-Cdk1/Cdc2 (PSTAIR) Antibody is a high quality Rabbit Polyclonal Antibody for the detection of Cdk1/Cdc2 (PSTAIR) & has been validated in ICC, IP & WB. pricing
MABE229 Anti-phospho-Cdk1 (Thr14, Tyr15)Antibody, clone CP3.2 Anti-phospho-Cdk1 (Thr14, Tyr15) Antibody, clone CP3.2 is a mouse monoclonal antibody for detection of phospho-Cdk1 (Thr14, Tyr15) also known as Cyclin-dependent kinase 1, or Cell division control protein 2 homolog & has been validated in WB, ICC. pricing
14-450-M Cdk1/cyclin B Protein, active, 10 µg Active, C-terminal His6-tagged human full length Cdk1 & N-terminal GST-tagged human full length Cyclin B, for use in Kinase Assays. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001786 siRNAs that have been validated in the lab human pricing
NM_033379 siRNAs that have been validated in the lab human pricing
NM_019296 Rosetta Predictions rat pricing
NM_007659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001786 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044053 validated 902
1 SASI_Hs01_00044049 validated 865
1 SASI_Hs01_00044050 validated 837
2 SASI_Hs01_00044051 predicted 823
3 SASI_Hs01_00044052 predicted 823
4 SASI_Hs01_00044054 predicted 815
5 SASI_Hs01_00044055 predicted 905
6 SASI_Hs01_00044056 predicted 869
7 SASI_Hs01_00044057 predicted 867
8 SASI_Hs02_00332548 predicted 817
9 SASI_Hs01_00044058 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033379 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056210 validated 577
2 SASI_Hs01_00056211 predicted 551
3 SASI_Hs01_00056212 predicted 536
4 SASI_Hs01_00056213 predicted 545
5 SASI_Hs01_00056214 predicted 617
6 SASI_Hs01_00056215 predicted 528
7 SASI_Hs01_00056216 predicted 619
8 SASI_Hs01_00056217 predicted 583
9 SASI_Hs01_00056218 predicted 577
10 SASI_Hs01_00056219 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082680 predicted 933
2 SASI_Rn01_00082681 predicted 766
3 SASI_Rn01_00082683 predicted 240
4 SASI_Rn01_00082684 predicted 230
5 SASI_Rn02_00262255 predicted 537
6 SASI_Rn01_00082685 predicted 579
7 SASI_Rn01_00082686 predicted 307
8 SASI_Rn01_00082687 predicted 553
9 SASI_Rn01_00082688 predicted 239
10 SASI_Rn01_00082689 predicted 770
11 SASI_Rn01_00082682 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179321 predicted 900
2 SASI_Mm01_00179322 predicted 1043
3 SASI_Mm01_00179324 predicted 391
4 SASI_Mm01_00179325 predicted 429
5 SASI_Mm01_00179326 predicted 242
6 SASI_Mm01_00179327 predicted 324
7 SASI_Mm01_00179328 predicted 921
8 SASI_Mm01_00179329 predicted 270
9 SASI_Mm01_00179330 predicted 770
10 SASI_Mm02_00312161 predicted 550
11 SASI_Mm01_00179323 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001786
VALIDATED
CDK1 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001786.4-798s21c1
Sequence:CCGGCTTTGGGCACTCCCAATAATGCTCGAGCATTATTGGGAGTGCCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001786.4-428s21c1
Sequence:CCGGCCTGGTCAGTACATGGATTCTCTCGAGAGAATCCATGTACTGACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001786.4-1007s21c1
Sequence:CCGGGATTTGGACAATCAGATTAAGCTCGAGCTTAATCTGATTGTCCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001786.4-344s21c1
Sequence:CCGGGATGTGCTTATGCAGGATTCCCTCGAGGGAATCCTGCATAAGCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001786.x-1131s1c1
Sequence:CCGGGCTGTACTTCGTCTTCTAATTCTCGAGAATTAGAAGACGAAGTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001786.x-820s1c1
Sequence:CCGGGTGGAATCTTTACAGGACTATCTCGAGATAGTCCTGTAAAGATTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001786.x-906s1c1
Sequence:CCGGTGGCTTGGATTTGCTCTCGAACTCGAGTTCGAGAGCAAATCCAAGCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001786.x-546s1c1
Sequence:CCGGAGGAACAATTAAACTGGCTGACTCGAGTCAGCCAGTTTAATTGTTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001786.x-349s1c1
Sequence:CCGGTCCAGGTTATATCTCATCTTTCTCGAGAAAGATGAGATATAACCTGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001786.2-1038s1c1
Sequence:CCGGGTTTCCATATGTTATGTCAACCTCGAGGTTGACATAACATATGGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001786.2-679s1c1
Sequence:CCGGCCAGTTGACATTTGGAGTATACTCGAGTATACTCCAAATGTCAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001786.2-748s1c1
Sequence:CCGGGATTCAGAAATTGATCAACTCCTCGAGGAGTTGATCAATTTCTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001786.2-307s1c1
Sequence:CCGGCATCCAAATATAGTCAGTCTTCTCGAGAAGACTGACTATATTTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001786
VALIDATED
CDK1 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001786.4-798s21c1
Sequence:CCGGCTTTGGGCACTCCCAATAATGCTCGAGCATTATTGGGAGTGCCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001786.4-428s21c1
Sequence:CCGGCCTGGTCAGTACATGGATTCTCTCGAGAGAATCCATGTACTGACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001786.4-1007s21c1
Sequence:CCGGGATTTGGACAATCAGATTAAGCTCGAGCTTAATCTGATTGTCCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001786.4-344s21c1
Sequence:CCGGGATGTGCTTATGCAGGATTCCCTCGAGGGAATCCTGCATAAGCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001786.x-1131s1c1
Sequence:CCGGGCTGTACTTCGTCTTCTAATTCTCGAGAATTAGAAGACGAAGTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001786.x-820s1c1
Sequence:CCGGGTGGAATCTTTACAGGACTATCTCGAGATAGTCCTGTAAAGATTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001786.x-906s1c1
Sequence:CCGGTGGCTTGGATTTGCTCTCGAACTCGAGTTCGAGAGCAAATCCAAGCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001786.x-546s1c1
Sequence:CCGGAGGAACAATTAAACTGGCTGACTCGAGTCAGCCAGTTTAATTGTTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001786.x-349s1c1
Sequence:CCGGTCCAGGTTATATCTCATCTTTCTCGAGAAAGATGAGATATAACCTGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001786.2-1038s1c1
Sequence:CCGGGTTTCCATATGTTATGTCAACCTCGAGGTTGACATAACATATGGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001786.2-679s1c1
Sequence:CCGGCCAGTTGACATTTGGAGTATACTCGAGTATACTCCAAATGTCAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001786.2-748s1c1
Sequence:CCGGGATTCAGAAATTGATCAACTCCTCGAGGAGTTGATCAATTTCTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001786.2-307s1c1
Sequence:CCGGCATCCAAATATAGTCAGTCTTCTCGAGAAGACTGACTATATTTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001786
VALIDATED
CDK1 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001786.4-798s21c1
Sequence:CCGGCTTTGGGCACTCCCAATAATGCTCGAGCATTATTGGGAGTGCCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001786.4-428s21c1
Sequence:CCGGCCTGGTCAGTACATGGATTCTCTCGAGAGAATCCATGTACTGACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001786.4-1007s21c1
Sequence:CCGGGATTTGGACAATCAGATTAAGCTCGAGCTTAATCTGATTGTCCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001786.4-344s21c1
Sequence:CCGGGATGTGCTTATGCAGGATTCCCTCGAGGGAATCCTGCATAAGCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001786.x-1131s1c1
Sequence:CCGGGCTGTACTTCGTCTTCTAATTCTCGAGAATTAGAAGACGAAGTACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001786.x-820s1c1
Sequence:CCGGGTGGAATCTTTACAGGACTATCTCGAGATAGTCCTGTAAAGATTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001786.x-906s1c1
Sequence:CCGGTGGCTTGGATTTGCTCTCGAACTCGAGTTCGAGAGCAAATCCAAGCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001786.x-546s1c1
Sequence:CCGGAGGAACAATTAAACTGGCTGACTCGAGTCAGCCAGTTTAATTGTTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001786.x-349s1c1
Sequence:CCGGTCCAGGTTATATCTCATCTTTCTCGAGAAAGATGAGATATAACCTGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001786.2-1038s1c1
Sequence:CCGGGTTTCCATATGTTATGTCAACCTCGAGGTTGACATAACATATGGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001786.2-679s1c1
Sequence:CCGGCCAGTTGACATTTGGAGTATACTCGAGTATACTCCAAATGTCAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_001786.2-748s1c1
Sequence:CCGGGATTCAGAAATTGATCAACTCCTCGAGGAGTTGATCAATTTCTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001786.2-307s1c1
Sequence:CCGGCATCCAAATATAGTCAGTCTTCTCGAGAAGACTGACTATATTTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007659
VALIDATED
CDK1 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007659.3-142s21c1
Sequence:CCGGTACTTACGGTGTGGTGTATAACTCGAGTTATACACCACACCGTAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007659.3-920s21c1
Sequence:CCGGGCCAAACGAATCTCTGGCAAACTCGAGTTTGCCAGAGATTCGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007659.3-1343s21c1
Sequence:CCGGCCTCCGTGTTCTGGATATATACTCGAGTATATATCCAGAACACGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007659.3-805s21c1
Sequence:CCGGGCAGGACTACAAGAACACCTTCTCGAGAAGGTGTTCTTGTAGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007659.3-328s21c1
Sequence:CCGGGCTGTATCTCATCTTTGAGTTCTCGAGAACTCAAAGATGAGATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007659.2-329s1c1
Sequence:CCGGGCTGTATCTCATCTTTGAGTTCTCGAGAACTCAAAGATGAGATACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007659.2-806s1c1
Sequence:CCGGGCAGGACTACAAGAACACCTTCTCGAGAAGGTGTTCTTGTAGTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007659.2-195s1c1
Sequence:CCGGGCCATGAAGAAGATCAGACTTCTCGAGAAGTCTGATCTTCTTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007659.2-654s1c1
Sequence:CCGGCCGGTTGACATCTGGAGTATACTCGAGTATACTCCAGATGTCAACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007659.2-921s1c1
Sequence:CCGGGCCAAACGAATCTCTGGCAAACTCGAGTTTGCCAGAGATTCGTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007659
VALIDATED
CDK1 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007659.3-142s21c1
Sequence:CCGGTACTTACGGTGTGGTGTATAACTCGAGTTATACACCACACCGTAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007659.3-920s21c1
Sequence:CCGGGCCAAACGAATCTCTGGCAAACTCGAGTTTGCCAGAGATTCGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007659.3-1343s21c1
Sequence:CCGGCCTCCGTGTTCTGGATATATACTCGAGTATATATCCAGAACACGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007659.3-805s21c1
Sequence:CCGGGCAGGACTACAAGAACACCTTCTCGAGAAGGTGTTCTTGTAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007659.3-328s21c1
Sequence:CCGGGCTGTATCTCATCTTTGAGTTCTCGAGAACTCAAAGATGAGATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007659.2-329s1c1
Sequence:CCGGGCTGTATCTCATCTTTGAGTTCTCGAGAACTCAAAGATGAGATACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007659.2-806s1c1
Sequence:CCGGGCAGGACTACAAGAACACCTTCTCGAGAAGGTGTTCTTGTAGTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007659.2-195s1c1
Sequence:CCGGGCCATGAAGAAGATCAGACTTCTCGAGAAGTCTGATCTTCTTCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007659.2-654s1c1
Sequence:CCGGCCGGTTGACATCTGGAGTATACTCGAGTATACTCCAGATGTCAACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007659.2-921s1c1
Sequence:CCGGGCCAAACGAATCTCTGGCAAACTCGAGTTTGCCAGAGATTCGTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007659
VALIDATED
CDK1 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007659.3-142s21c1
Sequence:CCGGTACTTACGGTGTGGTGTATAACTCGAGTTATACACCACACCGTAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007659.3-920s21c1
Sequence:CCGGGCCAAACGAATCTCTGGCAAACTCGAGTTTGCCAGAGATTCGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007659.3-1343s21c1
Sequence:CCGGCCTCCGTGTTCTGGATATATACTCGAGTATATATCCAGAACACGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007659.3-805s21c1
Sequence:CCGGGCAGGACTACAAGAACACCTTCTCGAGAAGGTGTTCTTGTAGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007659.3-328s21c1
Sequence:CCGGGCTGTATCTCATCTTTGAGTTCTCGAGAACTCAAAGATGAGATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007659.2-329s1c1
Sequence:CCGGGCTGTATCTCATCTTTGAGTTCTCGAGAACTCAAAGATGAGATACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007659.2-806s1c1
Sequence:CCGGGCAGGACTACAAGAACACCTTCTCGAGAAGGTGTTCTTGTAGTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007659.2-195s1c1
Sequence:CCGGGCCATGAAGAAGATCAGACTTCTCGAGAAGTCTGATCTTCTTCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007659.2-654s1c1
Sequence:CCGGCCGGTTGACATCTGGAGTATACTCGAGTATACTCCAGATGTCAACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007659.2-921s1c1
Sequence:CCGGGCCAAACGAATCTCTGGCAAACTCGAGTTTGCCAGAGATTCGTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)