EMAIL THIS PAGE TO A FRIEND

CDK20

cyclin-dependent kinase 20

137 Gene Product Result for
Synonyms: CCRK CDCH P42 PNQALRE
Gene ID:
Human(23552) Summary: The protein encoded by this gene contains a kinase domain most closely related to the cyclin-dependent protein kinases. The encoded kinase may activate cyclin-dependent kinase 2 and is involved in cell growth. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Dec 2009]
Mouse(105278) cyclin-dependent kinase 20
Rat(364666) cyclin-dependent kinase 20
Zebrafish(494112) cyclin-dependent kinase 20
cow(510920) cyclin-dependent kinase 20
domestic cat(101084656) cyclin-dependent kinase 20
dog(476354) cyclin-dependent kinase 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C6869 Anti-CCRK (381-395) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1407226 Anti-CCRK antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4501003 Anti-CCRK antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, western blot pricing
HPA027379 Anti-CDK20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human, mouse, rat
immunohistochemistry, western blot pricing
HPA027401 Anti-CDK20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab3 human
immunohistochemistry, western blot pricing
HPA007666 Anti-CDK20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunohistochemistry, western blot pricing
SAB1302235 ANTI-MOUSE CDK20 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
WH0023552M2 Monoclonal Anti-CCRK antibody produced in mouse clone 4D6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1404980 Monoclonal Anti-CCRK antibody produced in mouse clone 3E11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053180 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053180 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053180 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039803 Rosetta Predictions human pricing
NM_012119 Rosetta Predictions human pricing
NM_178432 Rosetta Predictions human pricing
NM_001025752 Rosetta Predictions rat pricing
NM_053180 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308677 predicted 1783
2 SASI_Hs01_00102680 predicted 1484
3 SASI_Hs02_00308678 predicted 1822
4 SASI_Hs01_00102681 predicted 1283
5 SASI_Hs01_00102682 predicted 1589
6 SASI_Hs01_00102683 predicted 1746
7 SASI_Hs01_00102684 predicted 1630
8 SASI_Hs01_00102685 predicted 1575
9 SASI_Hs02_00308679 predicted 1791
10 SASI_Hs01_00102687 predicted 1714
11 SASI_Hs01_00102686 predicted 1314
12 SASI_Hs01_00102688 predicted 1564
13 SASI_Hs01_00102689 predicted 1293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343661 predicted 1722
2 SASI_Hs01_00106428 predicted 1422
3 SASI_Hs02_00343662 predicted 1760
4 SASI_Hs01_00106429 predicted 1216
5 SASI_Hs01_00106430 predicted 1528
6 SASI_Hs01_00106431 predicted 1680
7 SASI_Hs01_00106432 predicted 1565
8 SASI_Hs01_00106433 predicted 1511
9 SASI_Hs02_00343663 predicted 1731
10 SASI_Hs01_00106435 predicted 1649
11 SASI_Hs01_00106434 predicted 1254
12 SASI_Hs01_00106436 predicted 1499
13 SASI_Hs01_00106437 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369665 predicted 1755
2 SASI_Hs01_00245362 predicted 1463
3 SASI_Hs02_00369666 predicted 1803
4 SASI_Hs01_00245363 predicted 1262
5 SASI_Hs01_00245364 predicted 1568
6 SASI_Hs01_00245365 predicted 1726
7 SASI_Hs01_00245366 predicted 1607
8 SASI_Hs01_00245367 predicted 1552
9 SASI_Hs02_00369667 predicted 1764
10 SASI_Hs01_00245369 predicted 1688
11 SASI_Hs01_00245368 predicted 1292
12 SASI_Hs01_00245370 predicted 1541
13 SASI_Hs01_00245371 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203412 predicted 1572
2 SASI_Rn02_00203413 predicted 1650
3 SASI_Rn02_00203414 predicted 1446
4 SASI_Rn02_00203415 predicted 1204
5 SASI_Rn02_00203416 predicted 386
6 SASI_Rn02_00203417 predicted 1674
7 SASI_Rn02_00203418 predicted 538
8 SASI_Rn02_00203419 predicted 343
9 SASI_Rn02_00203420 predicted 757
10 SASI_Rn01_00048220 predicted 741
11 SASI_Rn01_00048211 predicted 424
12 SASI_Rn01_00048212 predicted 1190
13 SASI_Rn01_00048213 predicted 252
14 SASI_Rn01_00048214 predicted 276
15 SASI_Rn01_00048215 predicted 435
16 SASI_Rn01_00048216 predicted 1053
17 SASI_Rn01_00048217 predicted 1261
18 SASI_Rn01_00048218 predicted 1150
19 SASI_Rn01_00048219 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149177 predicted 1524
2 SASI_Mm01_00149178 predicted 1356
3 SASI_Mm01_00149180 predicted 1242
4 SASI_Mm01_00149181 predicted 1477
5 SASI_Mm01_00149182 predicted 224
6 SASI_Mm01_00149183 predicted 210
7 SASI_Mm01_00149184 predicted 375
8 SASI_Mm02_00337737 predicted 1030
9 SASI_Mm01_00149185 predicted 1510
10 SASI_Mm01_00149186 predicted 1542
11 SASI_Mm01_00149179 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178432
VALIDATED
CDK20 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 20
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_178432.2-1171s1c1
Sequence:CCGGCCATCTGAGCTGCCGATTCCTCTCGAGAGGAATCGGCAGCTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178432.2-2123s1c1
Sequence:CCGGCAAGCGTTCCTGGAATTAATTCTCGAGAATTAATTCCAGGAACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_178432.2-1947s1c1
Sequence:CCGGCCTGTGTACTTCACATCACTGCTCGAGCAGTGATGTGAAGTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_178432.2-1075s1c1
Sequence:CCGGCTGGGTCAATTCCTTCTCTACCTCGAGGTAGAGAAGGAATTGACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178432.2-492s1c1
Sequence:CCGGGCGGGAGATTAAGGCTCTGCACTCGAGTGCAGAGCCTTAATCTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178432.x-1216s1c1
Sequence:CCGGTCTTGAGGAGTCGCTGTTGAACTCGAGTTCAACAGCGACTCCTCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178432.x-933s1c1
Sequence:CCGGTGCCGGACTACAACAAGATCTCTCGAGAGATCTTGTTGTAGTCCGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178432.x-2110s1c1
Sequence:CCGGCCCAATATAATCCCAGCTAGTCTCGAGACTAGCTGGGATTATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178432.x-852s1c1
Sequence:CCGGAGAACGATATTGAACAGCTTTCTCGAGAAAGCTGTTCAATATCGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-1267s21c1
Sequence:CCGGCATCCATGACTTCCACGTGGACTCGAGTCCACGTGGAAGTCATGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-1318s21c1
Sequence:CCGGAGAGCTGATTCGGCCCTTCATCTCGAGATGAAGGGCCGAATCAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178432.3-1778s21c1
Sequence:CCGGTTTATTCTCAGAGCCATTAAACTCGAGTTTAATGGCTCTGAGAATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-553s21c1
Sequence:CCGGCAATCAGTATGTGGTACAACTCTCGAGAGTTGTACCACATACTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-1161s21c1
Sequence:CCCGTCCATCAGTACTTCTTCACAGCTCGAGCTGTGAAGAAGTACTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-617s21c1
Sequence:CCGGGAGTTCATGCTGTCGGATCTGCTCGAGCAGATCCGACAGCATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178432
VALIDATED
CDK20 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 20
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_178432.2-1171s1c1
Sequence:CCGGCCATCTGAGCTGCCGATTCCTCTCGAGAGGAATCGGCAGCTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178432.2-2123s1c1
Sequence:CCGGCAAGCGTTCCTGGAATTAATTCTCGAGAATTAATTCCAGGAACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_178432.2-1947s1c1
Sequence:CCGGCCTGTGTACTTCACATCACTGCTCGAGCAGTGATGTGAAGTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_178432.2-1075s1c1
Sequence:CCGGCTGGGTCAATTCCTTCTCTACCTCGAGGTAGAGAAGGAATTGACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178432.2-492s1c1
Sequence:CCGGGCGGGAGATTAAGGCTCTGCACTCGAGTGCAGAGCCTTAATCTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178432.x-1216s1c1
Sequence:CCGGTCTTGAGGAGTCGCTGTTGAACTCGAGTTCAACAGCGACTCCTCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178432.x-933s1c1
Sequence:CCGGTGCCGGACTACAACAAGATCTCTCGAGAGATCTTGTTGTAGTCCGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178432.x-2110s1c1
Sequence:CCGGCCCAATATAATCCCAGCTAGTCTCGAGACTAGCTGGGATTATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178432.x-852s1c1
Sequence:CCGGAGAACGATATTGAACAGCTTTCTCGAGAAAGCTGTTCAATATCGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-1267s21c1
Sequence:CCGGCATCCATGACTTCCACGTGGACTCGAGTCCACGTGGAAGTCATGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-1318s21c1
Sequence:CCGGAGAGCTGATTCGGCCCTTCATCTCGAGATGAAGGGCCGAATCAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178432.3-1778s21c1
Sequence:CCGGTTTATTCTCAGAGCCATTAAACTCGAGTTTAATGGCTCTGAGAATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-553s21c1
Sequence:CCGGCAATCAGTATGTGGTACAACTCTCGAGAGTTGTACCACATACTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-1161s21c1
Sequence:CCCGTCCATCAGTACTTCTTCACAGCTCGAGCTGTGAAGAAGTACTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-617s21c1
Sequence:CCGGGAGTTCATGCTGTCGGATCTGCTCGAGCAGATCCGACAGCATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178432
VALIDATED
CDK20 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 20
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_178432.2-1171s1c1
Sequence:CCGGCCATCTGAGCTGCCGATTCCTCTCGAGAGGAATCGGCAGCTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178432.2-2123s1c1
Sequence:CCGGCAAGCGTTCCTGGAATTAATTCTCGAGAATTAATTCCAGGAACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_178432.2-1947s1c1
Sequence:CCGGCCTGTGTACTTCACATCACTGCTCGAGCAGTGATGTGAAGTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_178432.2-1075s1c1
Sequence:CCGGCTGGGTCAATTCCTTCTCTACCTCGAGGTAGAGAAGGAATTGACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178432.2-492s1c1
Sequence:CCGGGCGGGAGATTAAGGCTCTGCACTCGAGTGCAGAGCCTTAATCTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178432.x-1216s1c1
Sequence:CCGGTCTTGAGGAGTCGCTGTTGAACTCGAGTTCAACAGCGACTCCTCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178432.x-933s1c1
Sequence:CCGGTGCCGGACTACAACAAGATCTCTCGAGAGATCTTGTTGTAGTCCGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178432.x-2110s1c1
Sequence:CCGGCCCAATATAATCCCAGCTAGTCTCGAGACTAGCTGGGATTATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178432.x-852s1c1
Sequence:CCGGAGAACGATATTGAACAGCTTTCTCGAGAAAGCTGTTCAATATCGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-1267s21c1
Sequence:CCGGCATCCATGACTTCCACGTGGACTCGAGTCCACGTGGAAGTCATGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-1318s21c1
Sequence:CCGGAGAGCTGATTCGGCCCTTCATCTCGAGATGAAGGGCCGAATCAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178432.3-1778s21c1
Sequence:CCGGTTTATTCTCAGAGCCATTAAACTCGAGTTTAATGGCTCTGAGAATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-553s21c1
Sequence:CCGGCAATCAGTATGTGGTACAACTCTCGAGAGTTGTACCACATACTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-1161s21c1
Sequence:CCCGTCCATCAGTACTTCTTCACAGCTCGAGCTGTGAAGAAGTACTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178432.3-617s21c1
Sequence:CCGGGAGTTCATGCTGTCGGATCTGCTCGAGCAGATCCGACAGCATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053180
VALIDATED
CDK20 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 20
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053180.2-109s1c1
Sequence:CCGGGCACGTAGAGACTGGCGAGATCTCGAGATCTCGCCAGTCTCTACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053180.2-460s1c1
Sequence:CCGGCCAGCTCAAGATAGCTGACTTCTCGAGAAGTCAGCTATCTTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053180.2-374s1c1
Sequence:CCGGCTGCTCAAAGGTGTTGCGTTTCTCGAGAAACGCAACACCTTTGAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053180.2-1034s1c1
Sequence:CCGGGAGTCACTGTTGAACCCAGAACTCGAGTTCTGGGTTCAACAGTGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053180.2-209s1c1
Sequence:CCGGCAGGAGATAGAGGACAGTCAACTCGAGTTGACTGTCCTCTATCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053180.2-273s21c1
Sequence:CCGGTTGTGCTGGCTTTCGAATTTACTCGAGTAAATTCGAAAGCCAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053180.2-460s21c1
Sequence:CCGGCCAGCTCAAGATAGCTGACTTCTCGAGAAGTCAGCTATCTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053180.2-1477s21c1
Sequence:CCGGTCAGGATTTGAGGTTCATATACTCGAGTATATGAACCTCAAATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053180.2-854s21c1
Sequence:CCGGTACCCTCCACGACAGCGTATTCTCGAGAATACGCTGTCGTGGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053180.2-212s21c1
Sequence:CCGGGAGATAGAGGACAGTCAATATCTCGAGATATTGACTGTCCTCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053180
VALIDATED
CDK20 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 20
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053180.2-109s1c1
Sequence:CCGGGCACGTAGAGACTGGCGAGATCTCGAGATCTCGCCAGTCTCTACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053180.2-460s1c1
Sequence:CCGGCCAGCTCAAGATAGCTGACTTCTCGAGAAGTCAGCTATCTTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053180.2-374s1c1
Sequence:CCGGCTGCTCAAAGGTGTTGCGTTTCTCGAGAAACGCAACACCTTTGAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053180.2-1034s1c1
Sequence:CCGGGAGTCACTGTTGAACCCAGAACTCGAGTTCTGGGTTCAACAGTGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053180.2-209s1c1
Sequence:CCGGCAGGAGATAGAGGACAGTCAACTCGAGTTGACTGTCCTCTATCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053180.2-273s21c1
Sequence:CCGGTTGTGCTGGCTTTCGAATTTACTCGAGTAAATTCGAAAGCCAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053180.2-460s21c1
Sequence:CCGGCCAGCTCAAGATAGCTGACTTCTCGAGAAGTCAGCTATCTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053180.2-1477s21c1
Sequence:CCGGTCAGGATTTGAGGTTCATATACTCGAGTATATGAACCTCAAATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053180.2-854s21c1
Sequence:CCGGTACCCTCCACGACAGCGTATTCTCGAGAATACGCTGTCGTGGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053180.2-212s21c1
Sequence:CCGGGAGATAGAGGACAGTCAATATCTCGAGATATTGACTGTCCTCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053180
VALIDATED
CDK20 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 20
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053180.2-109s1c1
Sequence:CCGGGCACGTAGAGACTGGCGAGATCTCGAGATCTCGCCAGTCTCTACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053180.2-460s1c1
Sequence:CCGGCCAGCTCAAGATAGCTGACTTCTCGAGAAGTCAGCTATCTTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053180.2-374s1c1
Sequence:CCGGCTGCTCAAAGGTGTTGCGTTTCTCGAGAAACGCAACACCTTTGAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053180.2-1034s1c1
Sequence:CCGGGAGTCACTGTTGAACCCAGAACTCGAGTTCTGGGTTCAACAGTGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053180.2-209s1c1
Sequence:CCGGCAGGAGATAGAGGACAGTCAACTCGAGTTGACTGTCCTCTATCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053180.2-273s21c1
Sequence:CCGGTTGTGCTGGCTTTCGAATTTACTCGAGTAAATTCGAAAGCCAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053180.2-460s21c1
Sequence:CCGGCCAGCTCAAGATAGCTGACTTCTCGAGAAGTCAGCTATCTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053180.2-1477s21c1
Sequence:CCGGTCAGGATTTGAGGTTCATATACTCGAGTATATGAACCTCAAATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053180.2-854s21c1
Sequence:CCGGTACCCTCCACGACAGCGTATTCTCGAGAATACGCTGTCGTGGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053180.2-212s21c1
Sequence:CCGGGAGATAGAGGACAGTCAATATCTCGAGATATTGACTGTCCTCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks