EMAIL THIS PAGE TO A FRIEND

CDK2AP1

cyclin-dependent kinase 2 associated protein 1

65 Gene Product Result for
Synonyms: DOC1 DORC1 ST19 doc-1 p12DOC-1
UniProtKB ID: O14519, F5GYA4
Gene ID:
Human(8099) Summary: The protein encoded by this gene is a cyclin-dependent kinase 2 (CDK2) -associated protein which is thought to negatively regulate CDK2 activity by sequestering monomeric CDK2, and targeting CDK2 for proteolysis. This protein was found to also interact with DNA polymerase alpha/primase and mediate the phosphorylation of the large p180 subunit, which suggests a regulatory role in DNA replication during the S-phase of the cell cycle. This protein also forms a core subunit of the nucleosome remodeling and histone deacetylation (NURD) complex that epigenetically regulates embryonic stem cell differentiation. This gene thus plays a role in both cell-cycle and epigenetic regulation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
Mouse(13445) CDK2 (cyclin-dependent kinase 2)-associated protein 1
Rat(360804) cyclin-dependent kinase 2 associated protein 1
chicken(416826) cyclin-dependent kinase 2 associated protein 1
domestic cat(101089721) cyclin-dependent kinase 2 associated protein 1
cow(615387) cyclin-dependent kinase 2 associated protein 1
dog(477452) cyclin-dependent kinase 2 associated protein 1
domestic guinea pig(100734683) cyclin-dependent kinase 2 associated protein 1
naked mole-rat(101723683) cyclin-dependent kinase 2 associated protein 1
sheep(101122554) cyclin-dependent kinase 2 associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004642 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU093161 MISSION® esiRNA esiRNA targeting mouse Cdk2ap1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004642 Rosetta Predictions human pricing
NM_001113751 Rosetta Predictions rat pricing
NM_013812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113378 predicted 859
2 SASI_Hs01_00113379 predicted 1315
3 SASI_Hs01_00113381 predicted 1300
4 SASI_Hs01_00113382 predicted 1314
5 SASI_Hs01_00113384 predicted 851
6 SASI_Hs01_00113377 predicted 1358
7 SASI_Hs01_00113380 predicted 858
8 SASI_Hs02_00338050 predicted 786
9 SASI_Hs02_00338051 predicted 756
10 SASI_Hs01_00113386 predicted 1299
11 SASI_Hs01_00113383 predicted 1320
12 SASI_Hs01_00113385 predicted 1354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251973 predicted 657
2 SASI_Rn02_00251974 predicted 762
3 SASI_Rn02_00251975 predicted 781
4 SASI_Rn02_00251976 predicted 830
5 SASI_Rn02_00251977 predicted 535
6 SASI_Rn02_00251978 predicted 658
7 SASI_Rn02_00251979 predicted 783
8 SASI_Rn02_00251980 predicted 904
9 SASI_Rn02_00251981 predicted 869
10 SASI_Rn02_00251982 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042914 predicted 686
2 SASI_Mm01_00042915 predicted 883
3 SASI_Mm01_00042916 predicted 853
4 SASI_Mm01_00042917 predicted 693
5 SASI_Mm01_00042918 predicted 730
6 SASI_Mm01_00042919 predicted 1002
7 SASI_Mm01_00042920 predicted 1016
8 SASI_Mm01_00042921 predicted 1005
9 SASI_Mm01_00042922 predicted 564
10 SASI_Mm01_00042923 predicted 813
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013812
VALIDATED
CDK2AP1 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 2 associated protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013812.2-431s21c1
Sequence:CCGGTCAGAGTAAATATGCAGAGCTCTCGAGAGCTCTGCATATTTACTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013812.2-415s21c1
Sequence:CCGGGAAATAGCCAGGTGCCTCAGACTCGAGTCTGAGGCACCTGGCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013812.2-509s21c1
Sequence:CCGGGAGCGCCATGGAGAGGCTAAACTCGAGTTTAGCCTCTCCATGGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013812.1-250s1c1
Sequence:CCGGGCTGGCCATCATTGAAGAGTTCTCGAGAACTCTTCAATGATGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013812.1-366s1c1
Sequence:CCGGGCTTGGCTGAAACGGAACGGACTCGAGTCCGTTCCGTTTCAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013812.1-195s1c1
Sequence:CCGGGCTACACCCAGGGAACTGGAACTCGAGTTCCAGTTCCCTGGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013812.1-221s1c1
Sequence:CCGGCAGGTGCCTCAGAGTAAATATCTCGAGATATTTACTCTGAGGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013812.1-274s1c1
Sequence:CCGGGAAAGAGATCAGACCGACGTACTCGAGTACGTCGGTCTGATCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013812
VALIDATED
CDK2AP1 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 2 associated protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013812.2-431s21c1
Sequence:CCGGTCAGAGTAAATATGCAGAGCTCTCGAGAGCTCTGCATATTTACTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013812.2-415s21c1
Sequence:CCGGGAAATAGCCAGGTGCCTCAGACTCGAGTCTGAGGCACCTGGCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013812.2-509s21c1
Sequence:CCGGGAGCGCCATGGAGAGGCTAAACTCGAGTTTAGCCTCTCCATGGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013812.1-250s1c1
Sequence:CCGGGCTGGCCATCATTGAAGAGTTCTCGAGAACTCTTCAATGATGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013812.1-366s1c1
Sequence:CCGGGCTTGGCTGAAACGGAACGGACTCGAGTCCGTTCCGTTTCAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013812.1-195s1c1
Sequence:CCGGGCTACACCCAGGGAACTGGAACTCGAGTTCCAGTTCCCTGGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013812.1-221s1c1
Sequence:CCGGCAGGTGCCTCAGAGTAAATATCTCGAGATATTTACTCTGAGGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013812.1-274s1c1
Sequence:CCGGGAAAGAGATCAGACCGACGTACTCGAGTACGTCGGTCTGATCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013812
VALIDATED
CDK2AP1 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 2 associated protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013812.2-431s21c1
Sequence:CCGGTCAGAGTAAATATGCAGAGCTCTCGAGAGCTCTGCATATTTACTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013812.2-415s21c1
Sequence:CCGGGAAATAGCCAGGTGCCTCAGACTCGAGTCTGAGGCACCTGGCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013812.2-509s21c1
Sequence:CCGGGAGCGCCATGGAGAGGCTAAACTCGAGTTTAGCCTCTCCATGGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013812.1-250s1c1
Sequence:CCGGGCTGGCCATCATTGAAGAGTTCTCGAGAACTCTTCAATGATGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013812.1-366s1c1
Sequence:CCGGGCTTGGCTGAAACGGAACGGACTCGAGTCCGTTCCGTTTCAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013812.1-195s1c1
Sequence:CCGGGCTACACCCAGGGAACTGGAACTCGAGTTCCAGTTCCCTGGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013812.1-221s1c1
Sequence:CCGGCAGGTGCCTCAGAGTAAATATCTCGAGATATTTACTCTGAGGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013812.1-274s1c1
Sequence:CCGGGAAAGAGATCAGACCGACGTACTCGAGTACGTCGGTCTGATCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004642
VALIDATED
CDK2AP1 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 2 associated protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-744s21c1
Sequence:CCGGGAAGGAGATCAGACCCACGTACTCGAGTACGTGGGTCTGATCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-606s21c1
Sequence:CCGGCATGGCAACGTCTTCACAGTACTCGAGTACTGTGAAGACGTTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-837s21c1
Sequence:CCGGCTTGGCAGAAACGGAACGGAACTCGAGTTCCGTTCCGTTTCTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-865s21c1
Sequence:CCGGTCCTAGCTGCCTTGTTGGTTTCTCGAGAAACCAACAAGGCAGCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-1238s21c1
Sequence:CCGGCTAATACCACTGTAGGGATTTCTCGAGAAATCCCTACAGTGGTATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004642.2-837s1c1
Sequence:CCGGCTTGGCAGAAACGGAACGGAACTCGAGTTCCGTTCCGTTTCTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004642.2-744s1c1
Sequence:CCGGGAAGGAGATCAGACCCACGTACTCGAGTACGTGGGTCTGATCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004642.2-699s1c1
Sequence:CCGGCCAAAGCAAATACGCGGAGCTCTCGAGAGCTCCGCGTATTTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004642.2-799s1c1
Sequence:CCGGCGCGGCATCATTCACGCTAGACTCGAGTCTAGCGTGAATGATGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004642.2-606s1c1
Sequence:CCGGCATGGCAACGTCTTCACAGTACTCGAGTACTGTGAAGACGTTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004642
VALIDATED
CDK2AP1 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 2 associated protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-744s21c1
Sequence:CCGGGAAGGAGATCAGACCCACGTACTCGAGTACGTGGGTCTGATCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-606s21c1
Sequence:CCGGCATGGCAACGTCTTCACAGTACTCGAGTACTGTGAAGACGTTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-837s21c1
Sequence:CCGGCTTGGCAGAAACGGAACGGAACTCGAGTTCCGTTCCGTTTCTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-865s21c1
Sequence:CCGGTCCTAGCTGCCTTGTTGGTTTCTCGAGAAACCAACAAGGCAGCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-1238s21c1
Sequence:CCGGCTAATACCACTGTAGGGATTTCTCGAGAAATCCCTACAGTGGTATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004642.2-837s1c1
Sequence:CCGGCTTGGCAGAAACGGAACGGAACTCGAGTTCCGTTCCGTTTCTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004642.2-744s1c1
Sequence:CCGGGAAGGAGATCAGACCCACGTACTCGAGTACGTGGGTCTGATCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004642.2-699s1c1
Sequence:CCGGCCAAAGCAAATACGCGGAGCTCTCGAGAGCTCCGCGTATTTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004642.2-799s1c1
Sequence:CCGGCGCGGCATCATTCACGCTAGACTCGAGTCTAGCGTGAATGATGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004642.2-606s1c1
Sequence:CCGGCATGGCAACGTCTTCACAGTACTCGAGTACTGTGAAGACGTTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004642
VALIDATED
CDK2AP1 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 2 associated protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-744s21c1
Sequence:CCGGGAAGGAGATCAGACCCACGTACTCGAGTACGTGGGTCTGATCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-606s21c1
Sequence:CCGGCATGGCAACGTCTTCACAGTACTCGAGTACTGTGAAGACGTTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-837s21c1
Sequence:CCGGCTTGGCAGAAACGGAACGGAACTCGAGTTCCGTTCCGTTTCTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-865s21c1
Sequence:CCGGTCCTAGCTGCCTTGTTGGTTTCTCGAGAAACCAACAAGGCAGCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004642.2-1238s21c1
Sequence:CCGGCTAATACCACTGTAGGGATTTCTCGAGAAATCCCTACAGTGGTATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004642.2-837s1c1
Sequence:CCGGCTTGGCAGAAACGGAACGGAACTCGAGTTCCGTTCCGTTTCTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004642.2-744s1c1
Sequence:CCGGGAAGGAGATCAGACCCACGTACTCGAGTACGTGGGTCTGATCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004642.2-699s1c1
Sequence:CCGGCCAAAGCAAATACGCGGAGCTCTCGAGAGCTCCGCGTATTTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004642.2-799s1c1
Sequence:CCGGCGCGGCATCATTCACGCTAGACTCGAGTCTAGCGTGAATGATGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004642.2-606s1c1
Sequence:CCGGCATGGCAACGTCTTCACAGTACTCGAGTACTGTGAAGACGTTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks