EMAIL THIS PAGE TO A FRIEND

CDK2AP2

cyclin-dependent kinase 2 associated protein 2

72 Gene Product Result for
Synonyms: DOC-1R p14
UniProtKB ID: O75956
Gene ID:
Human(10263) Summary: This gene encodes a protein that interacts with cyclin-dependent kinase 2 associated protein 1. Pseudogenes associated with this gene are located on chromosomes 7 and 9. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
Mouse(52004) CDK2-associated protein 2
Rat(688405) cyclin-dependent kinase 2 associated protein 2
domestic guinea pig(100724464) cyclin-dependent kinase 2 associated protein 2
naked mole-rat(101699118) cyclin-dependent kinase 2 associated protein 2
sheep(101111140) cyclin-dependent kinase 2 associated protein 2
Zebrafish(494160) cyclin-dependent kinase 2 associated protein 2
cow(517206) cyclin-dependent kinase 2 associated protein 2
domestic cat(101092544) cyclin-dependent kinase 2 associated protein 2
dog(610458) cyclin-dependent kinase 2 associated protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005851 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU038401 MISSION® esiRNA esiRNA targeting mouse Cdk2ap2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005851 Rosetta Predictions human pricing
NM_001109498 Rosetta Predictions rat pricing
NM_026373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102445 predicted 840
2 SASI_Hs01_00102446 predicted 956
3 SASI_Hs01_00102447 predicted 663
4 SASI_Hs01_00102449 predicted 689
5 SASI_Hs01_00102450 predicted 668
6 SASI_Hs01_00102451 predicted 961
7 SASI_Hs01_00102452 predicted 914
8 SASI_Hs01_00102453 predicted 780
9 SASI_Hs01_00102454 predicted 958
10 SASI_Hs02_00340400 predicted 777
11 SASI_Hs01_00102448 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248989 predicted 594
2 SASI_Rn02_00248990 predicted 387
3 SASI_Rn02_00248991 predicted 677
4 SASI_Rn02_00248992 predicted 435
5 SASI_Rn02_00248993 predicted 345
6 SASI_Rn02_00248994 predicted 198
7 SASI_Rn02_00248995 predicted 586
8 SASI_Rn02_00248996 predicted 204
9 SASI_Rn02_00248997 predicted 404
10 SASI_Rn02_00248998 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064798 predicted 392
2 SASI_Mm01_00064799 predicted 611
3 SASI_Mm01_00064800 predicted 200
4 SASI_Mm01_00064801 predicted 599
5 SASI_Mm01_00064802 predicted 438
6 SASI_Mm01_00064803 predicted 340
7 SASI_Mm01_00064806 predicted 406
8 SASI_Mm02_00330101 predicted 682
9 SASI_Mm01_00064807 predicted 588
10 SASI_Mm02_00330102 predicted 451
11 SASI_Mm01_00064804 predicted 397
12 SASI_Mm01_00064805 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026373
VALIDATED
CDK2AP2 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 2 associated protein 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026373.1-745s1c1
Sequence:CCGGGCACTTACTCCTTAACTCTTACTCGAGTAAGAGTTAAGGAGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184133    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026373.1-738s1c1
Sequence:CCGGCCACACAGCACTTACTCCTTACTCGAGTAAGGAGTAAGTGCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026373.4-428s21c1
Sequence:CCGGTGGCAGAGACAGAACGCAATGCTCGAGCATTGCGTTCTGTCTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026373.4-613s21c1
Sequence:CCGGCGTCCAGTTGGCTGTACAAACCTCGAGGTTTGTACAGCCAACTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026373.4-347s21c1
Sequence:CCGGCCACCTATGCTGGTAGCAAGACTCGAGTCTTGCTACCAGCATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026373.4-212s21c1
Sequence:CCGGGACCGCTGTTTAACGACTTTGCTCGAGCAAAGTCGTTAAACAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026373.4-247s21c1
Sequence:CCGGGGGTATGTACAGGCGATGAAGCTCGAGCTTCATCGCCTGTACATACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026373
VALIDATED
CDK2AP2 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 2 associated protein 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026373.1-745s1c1
Sequence:CCGGGCACTTACTCCTTAACTCTTACTCGAGTAAGAGTTAAGGAGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184133    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026373.1-738s1c1
Sequence:CCGGCCACACAGCACTTACTCCTTACTCGAGTAAGGAGTAAGTGCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026373.4-428s21c1
Sequence:CCGGTGGCAGAGACAGAACGCAATGCTCGAGCATTGCGTTCTGTCTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026373.4-613s21c1
Sequence:CCGGCGTCCAGTTGGCTGTACAAACCTCGAGGTTTGTACAGCCAACTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026373.4-347s21c1
Sequence:CCGGCCACCTATGCTGGTAGCAAGACTCGAGTCTTGCTACCAGCATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026373.4-212s21c1
Sequence:CCGGGACCGCTGTTTAACGACTTTGCTCGAGCAAAGTCGTTAAACAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026373.4-247s21c1
Sequence:CCGGGGGTATGTACAGGCGATGAAGCTCGAGCTTCATCGCCTGTACATACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026373
VALIDATED
CDK2AP2 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 2 associated protein 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026373.1-745s1c1
Sequence:CCGGGCACTTACTCCTTAACTCTTACTCGAGTAAGAGTTAAGGAGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184133    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026373.1-738s1c1
Sequence:CCGGCCACACAGCACTTACTCCTTACTCGAGTAAGGAGTAAGTGCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026373.4-428s21c1
Sequence:CCGGTGGCAGAGACAGAACGCAATGCTCGAGCATTGCGTTCTGTCTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026373.4-613s21c1
Sequence:CCGGCGTCCAGTTGGCTGTACAAACCTCGAGGTTTGTACAGCCAACTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026373.4-347s21c1
Sequence:CCGGCCACCTATGCTGGTAGCAAGACTCGAGTCTTGCTACCAGCATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026373.4-212s21c1
Sequence:CCGGGACCGCTGTTTAACGACTTTGCTCGAGCAAAGTCGTTAAACAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026373.4-247s21c1
Sequence:CCGGGGGTATGTACAGGCGATGAAGCTCGAGCTTCATCGCCTGTACATACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005851
VALIDATED
CDK2AP2 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 2 associated protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-780s1c1
Sequence:CCGGGCTGTCAGTCATAGAGGAGATCTCGAGATCTCCTCTATGACTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-849s1c1
Sequence:CCGGGCGCCTGAAGAGAGGTATCATCTCGAGATGATACCTCTCTTCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-708s1c1
Sequence:CCGGGCCTTCCATGGGCTACGTGCACTCGAGTGCACGTAGCCCATGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-672s1c1
Sequence:CCGGCGCTCCTTTCAGACCGCTGTTCTCGAGAACAGCGGTCTGAAAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-883s1c1
Sequence:CCGGCTAGTCAGAGAGTGCCTGGCACTCGAGTGCCAGGCACTCTCTGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005851.3-849s21c1
Sequence:CCGGGCGCCTGAAGAGAGGTATCATCTCGAGATGATACCTCTCTTCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005851.3-683s21c1
Sequence:CCGGGACCGCTGTTTAACGACTTTGCTCGAGCAAAGTCGTTAAACAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005851.3-672s21c1
Sequence:CCGGCGCTCCTTTCAGACCGCTGTTCTCGAGAACAGCGGTCTGAAAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005851.3-1165s21c1
Sequence:CCGGAGTGTTGCCCACCGGAACTTTCTCGAGAAAGTTCCGGTGGGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005851.3-804s21c1
Sequence:CCGGCAAAGAGATCCGGCCTACCTACTCGAGTAGGTAGGCCGGATCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005851
VALIDATED
CDK2AP2 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 2 associated protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-780s1c1
Sequence:CCGGGCTGTCAGTCATAGAGGAGATCTCGAGATCTCCTCTATGACTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-849s1c1
Sequence:CCGGGCGCCTGAAGAGAGGTATCATCTCGAGATGATACCTCTCTTCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-708s1c1
Sequence:CCGGGCCTTCCATGGGCTACGTGCACTCGAGTGCACGTAGCCCATGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-672s1c1
Sequence:CCGGCGCTCCTTTCAGACCGCTGTTCTCGAGAACAGCGGTCTGAAAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-883s1c1
Sequence:CCGGCTAGTCAGAGAGTGCCTGGCACTCGAGTGCCAGGCACTCTCTGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005851.3-849s21c1
Sequence:CCGGGCGCCTGAAGAGAGGTATCATCTCGAGATGATACCTCTCTTCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005851.3-683s21c1
Sequence:CCGGGACCGCTGTTTAACGACTTTGCTCGAGCAAAGTCGTTAAACAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005851.3-672s21c1
Sequence:CCGGCGCTCCTTTCAGACCGCTGTTCTCGAGAACAGCGGTCTGAAAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005851.3-1165s21c1
Sequence:CCGGAGTGTTGCCCACCGGAACTTTCTCGAGAAAGTTCCGGTGGGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005851.3-804s21c1
Sequence:CCGGCAAAGAGATCCGGCCTACCTACTCGAGTAGGTAGGCCGGATCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005851
VALIDATED
CDK2AP2 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 2 associated protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-780s1c1
Sequence:CCGGGCTGTCAGTCATAGAGGAGATCTCGAGATCTCCTCTATGACTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-849s1c1
Sequence:CCGGGCGCCTGAAGAGAGGTATCATCTCGAGATGATACCTCTCTTCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-708s1c1
Sequence:CCGGGCCTTCCATGGGCTACGTGCACTCGAGTGCACGTAGCCCATGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-672s1c1
Sequence:CCGGCGCTCCTTTCAGACCGCTGTTCTCGAGAACAGCGGTCTGAAAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005851.3-883s1c1
Sequence:CCGGCTAGTCAGAGAGTGCCTGGCACTCGAGTGCCAGGCACTCTCTGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005851.3-849s21c1
Sequence:CCGGGCGCCTGAAGAGAGGTATCATCTCGAGATGATACCTCTCTTCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005851.3-683s21c1
Sequence:CCGGGACCGCTGTTTAACGACTTTGCTCGAGCAAAGTCGTTAAACAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005851.3-672s21c1
Sequence:CCGGCGCTCCTTTCAGACCGCTGTTCTCGAGAACAGCGGTCTGAAAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005851.3-1165s21c1
Sequence:CCGGAGTGTTGCCCACCGGAACTTTCTCGAGAAAGTTCCGGTGGGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005851.3-804s21c1
Sequence:CCGGCAAAGAGATCCGGCCTACCTACTCGAGTAGGTAGGCCGGATCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks