EMAIL THIS PAGE TO A FRIEND

CDK2AP2P3

cyclin-dependent kinase 2 associated protein 2 pseudogene 3

10 Gene Product Result for
Species: Human CDK2AP2P3(401525)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376869 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_376869 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269841 predicted 1037
2 SASI_Hs01_00269842 predicted 1024
3 SASI_Hs01_00269843 predicted 1015
4 SASI_Hs01_00269844 predicted 864
5 SASI_Hs01_00269845 predicted 944
6 SASI_Hs01_00269846 predicted 891
7 SASI_Hs01_00269847 predicted 1045
8 SASI_Hs01_00269848 predicted 880
9 SASI_Hs01_00269849 predicted 898
10 SASI_Hs01_00269850 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376869
CDK2AP2P3 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 2 associated protein 2 pseudogene 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000038129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376869.1-1182s1c1
Sequence:CCGGCGTCGGTTGTGTGCAGGCCATCTCGAGATGGCCTGCACACAACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376869.1-1238s1c1
Sequence:CCGGACACAGAACTGCTGTTGGTCACTCGAGTGACCAACAGCAGTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376869.1-1326s1c1
Sequence:CCGGGAGAGGTATCATCCATCCCTACTCGAGTAGGGATGGATGATACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376869.1-1195s1c1
Sequence:CCGGCAGGCCATGAAACCACCTGGTCTCGAGACCAGGTGGTTTCATGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376869
CDK2AP2P3 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 2 associated protein 2 pseudogene 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000038129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376869.1-1182s1c1
Sequence:CCGGCGTCGGTTGTGTGCAGGCCATCTCGAGATGGCCTGCACACAACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376869.1-1238s1c1
Sequence:CCGGACACAGAACTGCTGTTGGTCACTCGAGTGACCAACAGCAGTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376869.1-1326s1c1
Sequence:CCGGGAGAGGTATCATCCATCCCTACTCGAGTAGGGATGGATGATACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376869.1-1195s1c1
Sequence:CCGGCAGGCCATGAAACCACCTGGTCTCGAGACCAGGTGGTTTCATGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376869
CDK2AP2P3 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 2 associated protein 2 pseudogene 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000038129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376869.1-1182s1c1
Sequence:CCGGCGTCGGTTGTGTGCAGGCCATCTCGAGATGGCCTGCACACAACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376869.1-1238s1c1
Sequence:CCGGACACAGAACTGCTGTTGGTCACTCGAGTGACCAACAGCAGTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376869.1-1326s1c1
Sequence:CCGGGAGAGGTATCATCCATCCCTACTCGAGTAGGGATGGATGATACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376869.1-1195s1c1
Sequence:CCGGCAGGCCATGAAACCACCTGGTCTCGAGACCAGGTGGTTTCATGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks