EMAIL THIS PAGE TO A FRIEND

CDK3

cyclin-dependent kinase 3

36 Gene Product Result for
UniProtKB ID: Q00526
Gene ID:
Human(1018) Summary: This gene encodes a member of the cyclin-dependent protein kinase family. The protein promotes entry into S phase, in part by activating members of the E2F family of transcription factors. The protein also associates with cyclin C and phosphorylates the retinoblastoma 1 protein to promote exit from G0. [provided by RefSeq, Jul 2008]
chicken(429642) cyclin-dependent kinase 3
dog(483323) cyclin-dependent kinase 3
domestic cat(101082960) cyclin-dependent kinase 3
cow(618631) cyclin-dependent kinase 3
sheep(101107113) cyclin-dependent kinase 3
naked mole-rat(101703908) cyclin-dependent kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
O0886 Olomoucine ≥98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001258 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001258 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185672 predicted 654
2 SASI_Hs01_00185673 predicted 814
3 SASI_Hs02_00331442 predicted 1118
4 SASI_Hs02_00331443 predicted 1079
5 SASI_Hs01_00185674 predicted 228
6 SASI_Hs01_00185675 predicted 295
7 SASI_Hs02_00331444 predicted 1081
8 SASI_Hs02_00331445 predicted 1236
9 SASI_Hs01_00185676 predicted 295
10 SASI_Hs01_00185677 predicted 415
11 SASI_Hs01_00185678 predicted 720
12 SASI_Hs01_00185679 predicted 882
13 SASI_Hs01_00185680 predicted 651
14 SASI_Hs01_00185681 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001258
VALIDATED
CDK3 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 3
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.x-308s1c1
Sequence:CCGGAGGAAGCTCTATCTGGTGTTTCTCGAGAAACACCAGATAGAGCTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.x-618s1c1
Sequence:CCGGGCAAGTTCTATACCACAGCTGCTCGAGCAGCTGTGGTATAGAACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001258.x-1097s1c1
Sequence:CCGGGAGAGCAAAGCACTAAGGAATCTCGAGATTCCTTAGTGCTTTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.x-721s1c1
Sequence:CCGGGCTCTTTCGTATCTTTCGTATCTCGAGATACGAAAGATACGAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.1-977s1c1
Sequence:CCGGCAGTATGTGCTGCAGCGATTCCTCGAGGAATCGCTGCAGCACATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001258.1-431s1c1
Sequence:CCGGGTGAGTTTCTGCCACTCACATCTCGAGATGTGAGTGGCAGAAACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.1-985s1c1
Sequence:CCGGGCTGCAGCGATTCCGCCATTGCTCGAGCAATGGCGGAATCGCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.1-690s1c1
Sequence:CCGGCCCTGTTTCCTGGTGACTCTGCTCGAGCAGAGTCACCAGGAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.1-833s1c1
Sequence:CCGGGAAGAGATTGTGCCCAATCTGCTCGAGCAGATTGGGCACAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-979s21c1
Sequence:CCGGGCGATTCCGCCATTGAGAATGCTCGAGCATTCTCAATGGCGGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-228s21c1
Sequence:CCGGAGATCTCGCTGCTCAAGGAACCTCGAGGTTCCTTGAGCAGCGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-864s21c1
Sequence:CCGGTCATGCAACTCCTGCAGTATGCTCGAGCATACTGCAGGAGTTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-710s21c1
Sequence:GTACCGGCTCTTTCGTATCTTTCGTATGCTCGAGCATACGAAAGATACGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001258.2-1396s21c1
Sequence:CCGGCCAGTTCAGTCCCAAGTTAAACTCGAGTTTAACTTGGGACTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001258.2-765s21c1
Sequence:CCGGTCACCCAGCTGCCTGACTATACTCGAGTATAGTCAGGCAGCTGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-597s21c1
Sequence:CCGGTCTTGGGCAGCAAGTTCTATACTCGAGTATAGAACTTGCTGCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-288s21c1
Sequence:CCGGACAACGAGAGGAAGCTCTATCCTCGAGGATAGAGCTTCCTCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-124s21c1
Sequence:CCGGGGTGGTGTACAAGGCCAAGAACTCGAGTTCTTGGCCTTGTACACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-172s21c1
Sequence:CCGGGAAGAAGATCAGACTGGATTTCTCGAGAAATCCAGTCTGATCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001258
VALIDATED
CDK3 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 3
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.x-308s1c1
Sequence:CCGGAGGAAGCTCTATCTGGTGTTTCTCGAGAAACACCAGATAGAGCTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.x-618s1c1
Sequence:CCGGGCAAGTTCTATACCACAGCTGCTCGAGCAGCTGTGGTATAGAACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001258.x-1097s1c1
Sequence:CCGGGAGAGCAAAGCACTAAGGAATCTCGAGATTCCTTAGTGCTTTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.x-721s1c1
Sequence:CCGGGCTCTTTCGTATCTTTCGTATCTCGAGATACGAAAGATACGAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.1-977s1c1
Sequence:CCGGCAGTATGTGCTGCAGCGATTCCTCGAGGAATCGCTGCAGCACATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001258.1-431s1c1
Sequence:CCGGGTGAGTTTCTGCCACTCACATCTCGAGATGTGAGTGGCAGAAACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.1-985s1c1
Sequence:CCGGGCTGCAGCGATTCCGCCATTGCTCGAGCAATGGCGGAATCGCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.1-690s1c1
Sequence:CCGGCCCTGTTTCCTGGTGACTCTGCTCGAGCAGAGTCACCAGGAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.1-833s1c1
Sequence:CCGGGAAGAGATTGTGCCCAATCTGCTCGAGCAGATTGGGCACAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-979s21c1
Sequence:CCGGGCGATTCCGCCATTGAGAATGCTCGAGCATTCTCAATGGCGGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-228s21c1
Sequence:CCGGAGATCTCGCTGCTCAAGGAACCTCGAGGTTCCTTGAGCAGCGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-864s21c1
Sequence:CCGGTCATGCAACTCCTGCAGTATGCTCGAGCATACTGCAGGAGTTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-710s21c1
Sequence:GTACCGGCTCTTTCGTATCTTTCGTATGCTCGAGCATACGAAAGATACGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001258.2-1396s21c1
Sequence:CCGGCCAGTTCAGTCCCAAGTTAAACTCGAGTTTAACTTGGGACTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001258.2-765s21c1
Sequence:CCGGTCACCCAGCTGCCTGACTATACTCGAGTATAGTCAGGCAGCTGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-597s21c1
Sequence:CCGGTCTTGGGCAGCAAGTTCTATACTCGAGTATAGAACTTGCTGCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-288s21c1
Sequence:CCGGACAACGAGAGGAAGCTCTATCCTCGAGGATAGAGCTTCCTCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-124s21c1
Sequence:CCGGGGTGGTGTACAAGGCCAAGAACTCGAGTTCTTGGCCTTGTACACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-172s21c1
Sequence:CCGGGAAGAAGATCAGACTGGATTTCTCGAGAAATCCAGTCTGATCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001258
VALIDATED
CDK3 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 3
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.x-308s1c1
Sequence:CCGGAGGAAGCTCTATCTGGTGTTTCTCGAGAAACACCAGATAGAGCTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.x-618s1c1
Sequence:CCGGGCAAGTTCTATACCACAGCTGCTCGAGCAGCTGTGGTATAGAACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001258.x-1097s1c1
Sequence:CCGGGAGAGCAAAGCACTAAGGAATCTCGAGATTCCTTAGTGCTTTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.x-721s1c1
Sequence:CCGGGCTCTTTCGTATCTTTCGTATCTCGAGATACGAAAGATACGAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.1-977s1c1
Sequence:CCGGCAGTATGTGCTGCAGCGATTCCTCGAGGAATCGCTGCAGCACATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001258.1-431s1c1
Sequence:CCGGGTGAGTTTCTGCCACTCACATCTCGAGATGTGAGTGGCAGAAACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.1-985s1c1
Sequence:CCGGGCTGCAGCGATTCCGCCATTGCTCGAGCAATGGCGGAATCGCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.1-690s1c1
Sequence:CCGGCCCTGTTTCCTGGTGACTCTGCTCGAGCAGAGTCACCAGGAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001258.1-833s1c1
Sequence:CCGGGAAGAGATTGTGCCCAATCTGCTCGAGCAGATTGGGCACAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-979s21c1
Sequence:CCGGGCGATTCCGCCATTGAGAATGCTCGAGCATTCTCAATGGCGGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-228s21c1
Sequence:CCGGAGATCTCGCTGCTCAAGGAACCTCGAGGTTCCTTGAGCAGCGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-864s21c1
Sequence:CCGGTCATGCAACTCCTGCAGTATGCTCGAGCATACTGCAGGAGTTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-710s21c1
Sequence:GTACCGGCTCTTTCGTATCTTTCGTATGCTCGAGCATACGAAAGATACGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001258.2-1396s21c1
Sequence:CCGGCCAGTTCAGTCCCAAGTTAAACTCGAGTTTAACTTGGGACTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001258.2-765s21c1
Sequence:CCGGTCACCCAGCTGCCTGACTATACTCGAGTATAGTCAGGCAGCTGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-597s21c1
Sequence:CCGGTCTTGGGCAGCAAGTTCTATACTCGAGTATAGAACTTGCTGCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-288s21c1
Sequence:CCGGACAACGAGAGGAAGCTCTATCCTCGAGGATAGAGCTTCCTCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-124s21c1
Sequence:CCGGGGTGGTGTACAAGGCCAAGAACTCGAGTTCTTGGCCTTGTACACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001258.2-172s21c1
Sequence:CCGGGAAGAAGATCAGACTGGATTTCTCGAGAAATCCAGTCTGATCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks