EMAIL THIS PAGE TO A FRIEND

CDK4

cyclin-dependent kinase 4

Synonyms: CMM3 PSK-J3
UniProtKB ID: P11802, O00576, Q6FG61
Gene ID:
Human(1019) Summary: The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]
Mouse(12567) cyclin-dependent kinase 4
Rat(94201) cyclin-dependent kinase 4
naked mole-rat(101702608) cyclin-dependent kinase 4
domestic guinea pig(100717960) cyclin-dependent kinase 4
sheep(100144756) cyclin-dependent kinase 4
Domestic Rabbit(100009039) cyclin-dependent kinase 4
Zebrafish(777730) cyclin-dependent kinase 4
fruit fly(36854) Cyclin-dependent kinase 4
cow(510618) cyclin-dependent kinase 4
domestic cat(101097903) cyclin-dependent kinase 4
dog(481131) cyclin-dependent kinase 4
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV00001 Anti-CDK4 (AB1) antibody produced in rabbit IgG fraction of antiserum sheep, canine, bovine, pig, rat, human, rabbit
western blot pricing
AV03017 Anti-CDK4 (AB2) antibody produced in rabbit IgG fraction of antiserum rabbit, pig, human, canine, rat
western blot pricing
GW22309F Anti-CDK4 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
SAB1405599 Anti-CDK4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4300695 Anti-CDK4 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA006024 Anti-CDK4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1304744 ANTI-MOUSE CDK4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
C8218 Monoclonal Anti-Cdk4 antibody produced in mouse clone DCS-31, ascites fluid mouse, human, rat
immunocytochemistry, immunoprecipitation, microarray, western blot pricing
WH0001019M3 Monoclonal Anti-CDK4 antibody produced in mouse clone 4F11, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, western blot pricing
SAB1403657 Monoclonal Anti-CDK4, (C-terminal) antibody produced in mouse clone 2G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
O0886 Olomoucine ≥98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000075 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000075 siRNAs that have been validated in the lab human pricing
NM_053593 Rosetta Predictions rat pricing
NM_009870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000075 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122489 validated 825
1 SASI_Hs01_00122488 validated 1098
1 SASI_Hs01_00122490 validated 730
2 SASI_Hs01_00122491 predicted 1120
3 SASI_Hs01_00122492 predicted 1195
4 SASI_Hs01_00122493 predicted 595
5 SASI_Hs01_00122494 predicted 1168
6 SASI_Hs01_00122495 predicted 1100
7 SASI_Hs02_00301808 predicted 312
8 SASI_Hs01_00122496 predicted 426
9 SASI_Hs01_00122497 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080054 predicted 520
2 SASI_Rn01_00080055 predicted 641
3 SASI_Rn01_00080056 predicted 557
4 SASI_Rn01_00080057 predicted 1013
5 SASI_Rn01_00080058 predicted 994
6 SASI_Rn01_00080059 predicted 623
7 SASI_Rn01_00080060 predicted 544
8 SASI_Rn01_00080061 predicted 741
9 SASI_Rn01_00080062 predicted 443
10 SASI_Rn02_00266271 predicted 271
11 SASI_Rn01_00080063 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317323 predicted 253
2 SASI_Mm01_00032893 predicted 766
3 SASI_Mm02_00317324 predicted 215
4 SASI_Mm01_00032895 predicted 328
5 SASI_Mm01_00032902 predicted 511
6 SASI_Mm02_00317325 predicted 979
7 SASI_Mm02_00317326 predicted 424
8 SASI_Mm01_00032897 predicted 364
9 SASI_Mm02_00317327 predicted 270
10 SASI_Mm02_00317328 predicted 595
11 SASI_Mm01_00032894 predicted 460
12 SASI_Mm01_00032896 predicted 534
13 SASI_Mm01_00032898 predicted 407
14 SASI_Mm01_00032899 predicted 747
15 SASI_Mm01_00032900 predicted 1002
16 SASI_Mm01_00032901 predicted 610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009870
VALIDATED
CDK4 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009870.2-641s1c1
Sequence:CCGGCCTAGCTAGAATCTACAGCTACTCGAGTAGCTGTAGATTCTAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009870.2-258s1c1
Sequence:CCGGGCCCTCAAGAGTGTGAGAGTTCTCGAGAACTCTCACACTCTTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009870.2-846s1c1
Sequence:CCGGCTCATTGGATTGCCTCCAGAACTCGAGTTCTGGAGGCAATCCAATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009870.2-493s1c1
Sequence:CCGGGCCTGCCGGTTGAGACCATTACTCGAGTAATGGTCTCAACCGGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009870.2-404s1c1
Sequence:CCGGCCGAACTGATCGGGACATCAACTCGAGTTGATGTCCCGATCAGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-507s21c1
Sequence:CCGGCTGCCGGTTGAGACCATTAAGCTCGAGCTTAATGGTCTCAACCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-1195s21c1
Sequence:CCGGTTAAGCCTTAAATAACAAGTCCTCGAGGACTTGTTATTTAAGGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-334s21c1
Sequence:CCGGTTCGTGAGGTGGCCTTGTTAACTCGAGTTAACAAGGCCACCTCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-442s21c1
Sequence:CCGGCCCTAGTGTTTGAGCATATAGCTCGAGCTATATGCTCAAACACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-220s21c1
Sequence:CCGGCCTATGGGACGGTGTACAAAGCTCGAGCTTTGTACACCGTCCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009870
VALIDATED
CDK4 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009870.2-641s1c1
Sequence:CCGGCCTAGCTAGAATCTACAGCTACTCGAGTAGCTGTAGATTCTAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009870.2-258s1c1
Sequence:CCGGGCCCTCAAGAGTGTGAGAGTTCTCGAGAACTCTCACACTCTTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009870.2-846s1c1
Sequence:CCGGCTCATTGGATTGCCTCCAGAACTCGAGTTCTGGAGGCAATCCAATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009870.2-493s1c1
Sequence:CCGGGCCTGCCGGTTGAGACCATTACTCGAGTAATGGTCTCAACCGGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009870.2-404s1c1
Sequence:CCGGCCGAACTGATCGGGACATCAACTCGAGTTGATGTCCCGATCAGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-507s21c1
Sequence:CCGGCTGCCGGTTGAGACCATTAAGCTCGAGCTTAATGGTCTCAACCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-1195s21c1
Sequence:CCGGTTAAGCCTTAAATAACAAGTCCTCGAGGACTTGTTATTTAAGGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-334s21c1
Sequence:CCGGTTCGTGAGGTGGCCTTGTTAACTCGAGTTAACAAGGCCACCTCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-442s21c1
Sequence:CCGGCCCTAGTGTTTGAGCATATAGCTCGAGCTATATGCTCAAACACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-220s21c1
Sequence:CCGGCCTATGGGACGGTGTACAAAGCTCGAGCTTTGTACACCGTCCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009870
VALIDATED
CDK4 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009870.2-641s1c1
Sequence:CCGGCCTAGCTAGAATCTACAGCTACTCGAGTAGCTGTAGATTCTAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009870.2-258s1c1
Sequence:CCGGGCCCTCAAGAGTGTGAGAGTTCTCGAGAACTCTCACACTCTTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009870.2-846s1c1
Sequence:CCGGCTCATTGGATTGCCTCCAGAACTCGAGTTCTGGAGGCAATCCAATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009870.2-493s1c1
Sequence:CCGGGCCTGCCGGTTGAGACCATTACTCGAGTAATGGTCTCAACCGGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009870.2-404s1c1
Sequence:CCGGCCGAACTGATCGGGACATCAACTCGAGTTGATGTCCCGATCAGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-507s21c1
Sequence:CCGGCTGCCGGTTGAGACCATTAAGCTCGAGCTTAATGGTCTCAACCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-1195s21c1
Sequence:CCGGTTAAGCCTTAAATAACAAGTCCTCGAGGACTTGTTATTTAAGGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-334s21c1
Sequence:CCGGTTCGTGAGGTGGCCTTGTTAACTCGAGTTAACAAGGCCACCTCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-442s21c1
Sequence:CCGGCCCTAGTGTTTGAGCATATAGCTCGAGCTATATGCTCAAACACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009870.3-220s21c1
Sequence:CCGGCCTATGGGACGGTGTACAAAGCTCGAGCTTTGTACACCGTCCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000075
VALIDATED
CDK4 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 4
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-933s1c1
Sequence:CCGGATGACTGGCCTCGAGATGTACTCGAGTACATCTCGAGGCCAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-384s1c1
Sequence:CCGGACAGTTCGTGAGGTGGCTTTACTCGAGTAAAGCCACCTCACGAACTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-528s1c1
Sequence:CCGGAGGACATATCTGGACAAGGCACTCGAGTGCCTTGTCCAGATATGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-258s1c1
Sequence:CCGGGAAATTGGTGTCGGTGCCTATCTCGAGATAGGCACCGACACCAATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-608s1c1
Sequence:CCGGCCTAGATTTCCTTCATGCCAACTCGAGTTGGCATGAAGGAAATCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-1320s1c1
Sequence:CCGGCCTTCCCATTTCTCTACACTACTCGAGTAGTGTAGAGAAATGGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000075.x-485s1c1
Sequence:CCGGATCAAGGTAACCCTGGTGTTCTCGAGAACACCAGGGTTACCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-1213s1c1
Sequence:CCGGCTTTATCTCTGAGGCTATGGACTCGAGTCCATAGCCTCAGAGATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.2-1213s1c1
Sequence:CCGGTTTATCTCTGAGGCTATGGACCTCGAGGTCCATAGCCTCAGAGATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000075.2-818s1c1
Sequence:CCGGGTGGAGTGTTGGCTGTATCTTCTCGAGAAGATACAGCCAACACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197041    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000075.2-1190s1c1
Sequence:CCGGGACACTGAGAGGGCAATCTTTCTCGAGAAAGATTGCCCTCTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.2-621s1c1
Sequence:CCGGCATGCCAATTGCATCGTTCACCTCGAGGTGAACGATGCAATTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.2-1257s1c1
Sequence:CCGGGAGATTACTTTGCTGCCTTAACTCGAGTTAAGGCAGCAAAGTAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.2-780s1c1
Sequence:CCGGGTTCTTCTGCAGTCCACATATCTCGAGATATGTGGACTGCAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000075.2-1320s21c1
Sequence:CCGGCCTTCCCATTTCTCTACACTACTCGAGTAGTGTAGAGAAATGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000075.2-432s1c1
Sequence:CCGGCCCAATGTTGTCCGGCTGATGCTCGAGCATCAGCCGGACAACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000075.2-384s21c1
Sequence:CCGGACAGTTCGTGAGGTGGCTTTACTCGAGTAAAGCCACCTCACGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000075.2-818s21c1
Sequence:CCGGGTGGAGTGTTGGCTGTATCTTCTCGAGAAGATACAGCCAACACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000075.2-1257s21c1
Sequence:CCGGGAGATTACTTTGCTGCCTTAACTCGAGTTAAGGCAGCAAAGTAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000075
VALIDATED
CDK4 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 4
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-933s1c1
Sequence:CCGGATGACTGGCCTCGAGATGTACTCGAGTACATCTCGAGGCCAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-384s1c1
Sequence:CCGGACAGTTCGTGAGGTGGCTTTACTCGAGTAAAGCCACCTCACGAACTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-528s1c1
Sequence:CCGGAGGACATATCTGGACAAGGCACTCGAGTGCCTTGTCCAGATATGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-258s1c1
Sequence:CCGGGAAATTGGTGTCGGTGCCTATCTCGAGATAGGCACCGACACCAATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-608s1c1
Sequence:CCGGCCTAGATTTCCTTCATGCCAACTCGAGTTGGCATGAAGGAAATCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-1320s1c1
Sequence:CCGGCCTTCCCATTTCTCTACACTACTCGAGTAGTGTAGAGAAATGGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000075.x-485s1c1
Sequence:CCGGATCAAGGTAACCCTGGTGTTCTCGAGAACACCAGGGTTACCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-1213s1c1
Sequence:CCGGCTTTATCTCTGAGGCTATGGACTCGAGTCCATAGCCTCAGAGATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.2-1213s1c1
Sequence:CCGGTTTATCTCTGAGGCTATGGACCTCGAGGTCCATAGCCTCAGAGATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000075.2-818s1c1
Sequence:CCGGGTGGAGTGTTGGCTGTATCTTCTCGAGAAGATACAGCCAACACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197041    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000075.2-1190s1c1
Sequence:CCGGGACACTGAGAGGGCAATCTTTCTCGAGAAAGATTGCCCTCTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.2-621s1c1
Sequence:CCGGCATGCCAATTGCATCGTTCACCTCGAGGTGAACGATGCAATTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.2-1257s1c1
Sequence:CCGGGAGATTACTTTGCTGCCTTAACTCGAGTTAAGGCAGCAAAGTAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.2-780s1c1
Sequence:CCGGGTTCTTCTGCAGTCCACATATCTCGAGATATGTGGACTGCAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000075.2-1320s21c1
Sequence:CCGGCCTTCCCATTTCTCTACACTACTCGAGTAGTGTAGAGAAATGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000075.2-432s1c1
Sequence:CCGGCCCAATGTTGTCCGGCTGATGCTCGAGCATCAGCCGGACAACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000075.2-384s21c1
Sequence:CCGGACAGTTCGTGAGGTGGCTTTACTCGAGTAAAGCCACCTCACGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000075.2-818s21c1
Sequence:CCGGGTGGAGTGTTGGCTGTATCTTCTCGAGAAGATACAGCCAACACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000075.2-1257s21c1
Sequence:CCGGGAGATTACTTTGCTGCCTTAACTCGAGTTAAGGCAGCAAAGTAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000075
VALIDATED
CDK4 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 4
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-933s1c1
Sequence:CCGGATGACTGGCCTCGAGATGTACTCGAGTACATCTCGAGGCCAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-384s1c1
Sequence:CCGGACAGTTCGTGAGGTGGCTTTACTCGAGTAAAGCCACCTCACGAACTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-528s1c1
Sequence:CCGGAGGACATATCTGGACAAGGCACTCGAGTGCCTTGTCCAGATATGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-258s1c1
Sequence:CCGGGAAATTGGTGTCGGTGCCTATCTCGAGATAGGCACCGACACCAATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-608s1c1
Sequence:CCGGCCTAGATTTCCTTCATGCCAACTCGAGTTGGCATGAAGGAAATCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-1320s1c1
Sequence:CCGGCCTTCCCATTTCTCTACACTACTCGAGTAGTGTAGAGAAATGGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000075.x-485s1c1
Sequence:CCGGATCAAGGTAACCCTGGTGTTCTCGAGAACACCAGGGTTACCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.x-1213s1c1
Sequence:CCGGCTTTATCTCTGAGGCTATGGACTCGAGTCCATAGCCTCAGAGATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.2-1213s1c1
Sequence:CCGGTTTATCTCTGAGGCTATGGACCTCGAGGTCCATAGCCTCAGAGATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000075.2-818s1c1
Sequence:CCGGGTGGAGTGTTGGCTGTATCTTCTCGAGAAGATACAGCCAACACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197041    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000075.2-1190s1c1
Sequence:CCGGGACACTGAGAGGGCAATCTTTCTCGAGAAAGATTGCCCTCTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.2-621s1c1
Sequence:CCGGCATGCCAATTGCATCGTTCACCTCGAGGTGAACGATGCAATTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.2-1257s1c1
Sequence:CCGGGAGATTACTTTGCTGCCTTAACTCGAGTTAAGGCAGCAAAGTAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000075.2-780s1c1
Sequence:CCGGGTTCTTCTGCAGTCCACATATCTCGAGATATGTGGACTGCAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000075.2-1320s21c1
Sequence:CCGGCCTTCCCATTTCTCTACACTACTCGAGTAGTGTAGAGAAATGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000075.2-432s1c1
Sequence:CCGGCCCAATGTTGTCCGGCTGATGCTCGAGCATCAGCCGGACAACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000075.2-384s21c1
Sequence:CCGGACAGTTCGTGAGGTGGCTTTACTCGAGTAAAGCCACCTCACGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000075.2-818s21c1
Sequence:CCGGGTGGAGTGTTGGCTGTATCTTCTCGAGAAGATACAGCCAACACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000075.2-1257s21c1
Sequence:CCGGGAGATTACTTTGCTGCCTTAACTCGAGTTAAGGCAGCAAAGTAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks