EMAIL THIS PAGE TO A FRIEND

CDK5

cyclin-dependent kinase 5

106 Gene Product Result for
Synonyms: PSSALRE
UniProtKB ID: Q00535, A1XKG3
Gene ID:
Mouse(12568) cyclin-dependent kinase 5
Rat(140908) cyclin-dependent kinase 5
Zebrafish(65234) cyclin-dependent protein kinase 5
fruit fly(36727) Cyclin-dependent kinase 5
domestic cat(101097226) cyclin-dependent kinase 5
cow(281066) cyclin-dependent kinase 5
dog(475537) cyclin-dependent kinase 5
chicken(100190948) cyclin-dependent kinase 5
sheep(100190973) cyclin-dependent kinase 5
domestic guinea pig(100732840) cyclin-dependent kinase 5
naked mole-rat(101708843) cyclin-dependent kinase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38525 Anti-CDK5 (AB1) antibody produced in rabbit IgG fraction of antiserum zebrafish, pig, guinea pig, mouse, rat, human, sheep, bovine, canine, horse, rabbit
western blot pricing
AV38526 Anti-CDK5 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, horse, canine, rat, guinea pig, zebrafish, pig, sheep, bovine, human, rabbit,
western blot pricing
SAB1405600 Anti-CDK5 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
immunofluorescence, western blot pricing
SAB2702423 Anti-Cdk5 antibody produced in rabbit affinity isolated antibody zebrafish
pricing
SAB2702487 Anti-Cdk5 antibody produced in rabbit affinity isolated antibody zebrafish
pricing
HPA018977 Anti-CDK5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2100390 Anti-CDK5 antibody produced in rabbit affinity isolated antibody human, bovine, pig, mouse, rat, zebrafish, horse
western blot pricing
HPA064535 Anti-CDK5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4500057 Anti-CDK5, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB1304743 ANTI-MOUSE CDK5 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4504276 Anti-phospho-CDK5 (pTyr15) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4301418 Anti-phospho-CDK5 (pTyr15) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
C6118 Monoclonal Anti-Cdk5 antibody produced in mouse ~2 mg/mL, clone CDK-3G, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
WH0001020M1 Monoclonal Anti-CDK5 antibody produced in mouse clone 1A2, ascites fluid, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A3145 Apigenin ≥97% (TLC), from parsley, powder human, mouse, rat pricing
10798 Apigenin ≥95.0% (HPLC) human, mouse, rat pricing
SMB00702 Apigenin ≥97% (TLC), from citrus New human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004935 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004935 siRNAs that have been validated in the lab human pricing
NM_080885 Rosetta Predictions rat pricing
NM_007668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004935 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159314 validated 777
1 SASI_Hs01_00159317 validated 515
2 SASI_Hs01_00159313 predicted 641
3 SASI_Hs01_00159315 predicted 789
4 SASI_Hs01_00159316 predicted 758
5 SASI_Hs02_00338604 predicted 363
6 SASI_Hs01_00159318 predicted 343
7 SASI_Hs02_00338605 predicted 668
8 SASI_Hs01_00159320 predicted 271
9 SASI_Hs01_00159322 predicted 400
10 SASI_Hs01_00159319 predicted 480
11 SASI_Hs01_00159321 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084288 predicted 507
2 SASI_Rn01_00084289 predicted 706
3 SASI_Rn01_00084290 predicted 386
4 SASI_Rn01_00084291 predicted 678
5 SASI_Rn01_00084292 predicted 562
6 SASI_Rn01_00084293 predicted 802
7 SASI_Rn02_00267336 predicted 881
8 SASI_Rn01_00084294 predicted 543
9 SASI_Rn01_00084296 predicted 430
10 SASI_Rn02_00267337 predicted 205
11 SASI_Rn01_00084295 predicted 289
12 SASI_Rn01_00084297 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052852 predicted 772
2 SASI_Mm01_00052853 predicted 744
3 SASI_Mm01_00052854 predicted 756
4 SASI_Mm01_00052855 predicted 340
5 SASI_Mm02_00312175 predicted 655
6 SASI_Mm01_00052856 predicted 294
7 SASI_Mm01_00052857 predicted 1194
8 SASI_Mm01_00052858 predicted 888
9 SASI_Mm01_00052859 predicted 1296
10 SASI_Mm01_00052861 predicted 1292
11 SASI_Mm01_00052860 predicted 1176
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004935
VALIDATED
CDK5 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004935.2-851s21c1
Sequence:CCGGCAGAACCTTCTGAAGTGTAACCTCGAGGTTACACTTCAGAAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004935.2-874s21c1
Sequence:CCGGTGTCCAGCGTATCTCAGCAGACTCGAGTCTGCTGAGATACGCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-806s1c1
Sequence:CCGGGTGAACGTCGTGCCCAAACTCCTCGAGGAGTTTGGGCACGACGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-359s1c1
Sequence:CCGGCCTGAGATTGTAAAGTCATTCCTCGAGGAATGACTTTACAATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-851s1c1
Sequence:CCGGCAGAACCTTCTGAAGTGTAACCTCGAGGTTACACTTCAGAAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004935.2-971s1c1
Sequence:CCGGCCTGGCCTATTTAAGCCCCCTCTCGAGAGGGGGCTTAAATAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-208s1c1
Sequence:CCGGCCGGGAGATCTGCCTACTCAACTCGAGTTGAGTAGGCAGATCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021465    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-822s1c1
Sequence:CCGGTCTGAAGTGTAACCCTGTCCACTCGAGTGGACAGGGTTACACTTCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021466    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-837s1c1
Sequence:CCGGTGTCCAGCGTATCTCAGCAGACTCGAGTCTGCTGAGATACGCTGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021468    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_004935.2-335s1c1
Sequence:CCGGAGTCATTCCTCTTCCAGCTACCTCGAGGTAGCTGGAAGAGGAATGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004935
VALIDATED
CDK5 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004935.2-851s21c1
Sequence:CCGGCAGAACCTTCTGAAGTGTAACCTCGAGGTTACACTTCAGAAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004935.2-874s21c1
Sequence:CCGGTGTCCAGCGTATCTCAGCAGACTCGAGTCTGCTGAGATACGCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-806s1c1
Sequence:CCGGGTGAACGTCGTGCCCAAACTCCTCGAGGAGTTTGGGCACGACGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-359s1c1
Sequence:CCGGCCTGAGATTGTAAAGTCATTCCTCGAGGAATGACTTTACAATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-851s1c1
Sequence:CCGGCAGAACCTTCTGAAGTGTAACCTCGAGGTTACACTTCAGAAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004935.2-971s1c1
Sequence:CCGGCCTGGCCTATTTAAGCCCCCTCTCGAGAGGGGGCTTAAATAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-208s1c1
Sequence:CCGGCCGGGAGATCTGCCTACTCAACTCGAGTTGAGTAGGCAGATCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021465    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-822s1c1
Sequence:CCGGTCTGAAGTGTAACCCTGTCCACTCGAGTGGACAGGGTTACACTTCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021466    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-837s1c1
Sequence:CCGGTGTCCAGCGTATCTCAGCAGACTCGAGTCTGCTGAGATACGCTGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021468    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_004935.2-335s1c1
Sequence:CCGGAGTCATTCCTCTTCCAGCTACCTCGAGGTAGCTGGAAGAGGAATGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004935
VALIDATED
CDK5 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004935.2-851s21c1
Sequence:CCGGCAGAACCTTCTGAAGTGTAACCTCGAGGTTACACTTCAGAAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004935.2-874s21c1
Sequence:CCGGTGTCCAGCGTATCTCAGCAGACTCGAGTCTGCTGAGATACGCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-806s1c1
Sequence:CCGGGTGAACGTCGTGCCCAAACTCCTCGAGGAGTTTGGGCACGACGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-359s1c1
Sequence:CCGGCCTGAGATTGTAAAGTCATTCCTCGAGGAATGACTTTACAATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-851s1c1
Sequence:CCGGCAGAACCTTCTGAAGTGTAACCTCGAGGTTACACTTCAGAAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004935.2-971s1c1
Sequence:CCGGCCTGGCCTATTTAAGCCCCCTCTCGAGAGGGGGCTTAAATAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-208s1c1
Sequence:CCGGCCGGGAGATCTGCCTACTCAACTCGAGTTGAGTAGGCAGATCTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021465    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-822s1c1
Sequence:CCGGTCTGAAGTGTAACCCTGTCCACTCGAGTGGACAGGGTTACACTTCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021466    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004935.2-837s1c1
Sequence:CCGGTGTCCAGCGTATCTCAGCAGACTCGAGTCTGCTGAGATACGCTGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021468    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_004935.2-335s1c1
Sequence:CCGGAGTCATTCCTCTTCCAGCTACCTCGAGGTAGCTGGAAGAGGAATGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007668
VALIDATED
CDK5 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007668.3-193s21c1
Sequence:CCGGCGGGAGATCTGTCTACTCAAACTCGAGTTTGAGTAGACAGATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007668.3-768s21c1
Sequence:CCGGGTACCCAGCTACAACATCCTTCTCGAGAAGGATGTTGTAGCTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007668.3-840s21c1
Sequence:CCGGCCTATTGAAGTGTAACCCTGTCTCGAGACAGGGTTACACTTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007668.3-342s21c1
Sequence:CCGGCCCTGAGATTGTGAAGTCATTCTCGAGAATGACTTCACAATCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007668.3-1069s21c1
Sequence:CCGGCCCTCCGTGGACTTTATTTAACTCGAGTTAAATAAAGTCCACGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-1069s1c1
Sequence:CCGGCCCTCCGTGGACTTTATTTAACTCGAGTTAAATAAAGTCCACGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-342s1c1
Sequence:CCGGCCCTGAGATTGTGAAGTCATTCTCGAGAATGACTTCACAATCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-840s1c1
Sequence:CCGGCCTATTGAAGTGTAACCCTGTCTCGAGACAGGGTTACACTTCAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-193s1c1
Sequence:CCGGCGGGAGATCTGTCTACTCAAACTCGAGTTTGAGTAGACAGATCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-768s1c1
Sequence:CCGGGTACCCAGCTACAACATCCTTCTCGAGAAGGATGTTGTAGCTGGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007668
VALIDATED
CDK5 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007668.3-193s21c1
Sequence:CCGGCGGGAGATCTGTCTACTCAAACTCGAGTTTGAGTAGACAGATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007668.3-768s21c1
Sequence:CCGGGTACCCAGCTACAACATCCTTCTCGAGAAGGATGTTGTAGCTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007668.3-840s21c1
Sequence:CCGGCCTATTGAAGTGTAACCCTGTCTCGAGACAGGGTTACACTTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007668.3-342s21c1
Sequence:CCGGCCCTGAGATTGTGAAGTCATTCTCGAGAATGACTTCACAATCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007668.3-1069s21c1
Sequence:CCGGCCCTCCGTGGACTTTATTTAACTCGAGTTAAATAAAGTCCACGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-1069s1c1
Sequence:CCGGCCCTCCGTGGACTTTATTTAACTCGAGTTAAATAAAGTCCACGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-342s1c1
Sequence:CCGGCCCTGAGATTGTGAAGTCATTCTCGAGAATGACTTCACAATCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-840s1c1
Sequence:CCGGCCTATTGAAGTGTAACCCTGTCTCGAGACAGGGTTACACTTCAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-193s1c1
Sequence:CCGGCGGGAGATCTGTCTACTCAAACTCGAGTTTGAGTAGACAGATCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-768s1c1
Sequence:CCGGGTACCCAGCTACAACATCCTTCTCGAGAAGGATGTTGTAGCTGGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007668
VALIDATED
CDK5 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007668.3-193s21c1
Sequence:CCGGCGGGAGATCTGTCTACTCAAACTCGAGTTTGAGTAGACAGATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007668.3-768s21c1
Sequence:CCGGGTACCCAGCTACAACATCCTTCTCGAGAAGGATGTTGTAGCTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007668.3-840s21c1
Sequence:CCGGCCTATTGAAGTGTAACCCTGTCTCGAGACAGGGTTACACTTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007668.3-342s21c1
Sequence:CCGGCCCTGAGATTGTGAAGTCATTCTCGAGAATGACTTCACAATCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007668.3-1069s21c1
Sequence:CCGGCCCTCCGTGGACTTTATTTAACTCGAGTTAAATAAAGTCCACGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-1069s1c1
Sequence:CCGGCCCTCCGTGGACTTTATTTAACTCGAGTTAAATAAAGTCCACGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-342s1c1
Sequence:CCGGCCCTGAGATTGTGAAGTCATTCTCGAGAATGACTTCACAATCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-840s1c1
Sequence:CCGGCCTATTGAAGTGTAACCCTGTCTCGAGACAGGGTTACACTTCAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-193s1c1
Sequence:CCGGCGGGAGATCTGTCTACTCAAACTCGAGTTTGAGTAGACAGATCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007668.2-768s1c1
Sequence:CCGGGTACCCAGCTACAACATCCTTCTCGAGAAGGATGTTGTAGCTGGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks