EMAIL THIS PAGE TO A FRIEND

CDK5PS

cyclin-dependent kinase 5 pseudogene

Gene Product Result for
Species: Human CDK5PS(392265)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_498294
CDK5PS MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 5 pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-298s1c1
Sequence:CCGGCCTGAGATTGTAAAGTCATTTCTCGAGAAATGACTTTACAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-696s1c1
Sequence:CCGGGCTGCCAGACTATAAGCTGTACTCGAGTACAGCTTATAGTCTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-79s1c1
Sequence:CCGGCATGAGATTGTGGCTCTGAAACTCGAGTTTCAGAGCCACAATCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-502s1c1
Sequence:CCGGCACCCACCAGATGTCTTCTTTCTCGAGAAAGAAGACATCTGGTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-705s1c1
Sequence:CCGGCTATAAGCTGTACCCATTGTACTCGAGTACAATGGGTACAGCTTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_498294
CDK5PS MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 5 pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-298s1c1
Sequence:CCGGCCTGAGATTGTAAAGTCATTTCTCGAGAAATGACTTTACAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-696s1c1
Sequence:CCGGGCTGCCAGACTATAAGCTGTACTCGAGTACAGCTTATAGTCTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-79s1c1
Sequence:CCGGCATGAGATTGTGGCTCTGAAACTCGAGTTTCAGAGCCACAATCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-502s1c1
Sequence:CCGGCACCCACCAGATGTCTTCTTTCTCGAGAAAGAAGACATCTGGTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-705s1c1
Sequence:CCGGCTATAAGCTGTACCCATTGTACTCGAGTACAATGGGTACAGCTTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_498294
CDK5PS MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 5 pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-298s1c1
Sequence:CCGGCCTGAGATTGTAAAGTCATTTCTCGAGAAATGACTTTACAATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-696s1c1
Sequence:CCGGGCTGCCAGACTATAAGCTGTACTCGAGTACAGCTTATAGTCTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-79s1c1
Sequence:CCGGCATGAGATTGTGGCTCTGAAACTCGAGTTTCAGAGCCACAATCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-502s1c1
Sequence:CCGGCACCCACCAGATGTCTTCTTTCTCGAGAAAGAAGACATCTGGTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498294.1-705s1c1
Sequence:CCGGCTATAAGCTGTACCCATTGTACTCGAGTACAATGGGTACAGCTTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks