EMAIL THIS PAGE TO A FRIEND

CDK5R1

cyclin-dependent kinase 5, regulatory subunit 1 (p35)

156 Gene Product Result for
Synonyms: CDK5P35 CDK5R NCK5A p23 p25 p35 p35nck5a
UniProtKB ID: Q15078, E1P664, Q5U0G3
Gene ID:
Human(8851) Summary: The protein encoded by this gene (p35) is a neuron-specific activator of cyclin-dependent kinase 5 (CDK5); the activation of CDK5 is required for proper development of the central nervous system. The p35 form of this protein is proteolytically cleaved by calpain, generating a p25 form. The cleavage of p35 into p25 results in relocalization of the protein from the cell periphery to nuclear and perinuclear regions. P25 deregulates CDK5 activity by prolonging its activation and changing its cellular location. The p25 form accumulates in the brain neurons of patients with Alzheimer's disease. This accumulation correlates with an increase in CDK5 kinase activity, and may lead to aberrantly phosphorylated forms of the microtubule-associated protein tau, which contributes to Alzheimer's disease. [provided by RefSeq, Jul 2008]
Mouse(12569) cyclin-dependent kinase 5, regulatory subunit 1 (p35)
Rat(116671) cyclin-dependent kinase 5, regulatory subunit 1 (p35)
dog(491154) cyclin-dependent kinase 5, regulatory subunit 1 (p35)
cow(282173) cyclin-dependent kinase 5, regulatory subunit 1 (p35)
domestic cat(101094890) cyclin-dependent kinase 5, regulatory subunit 1 (p35)
naked mole-rat(101725041) cyclin-dependent kinase 5, regulatory subunit 1 (p35)
domestic guinea pig(100718674) cyclin-dependent kinase 5, regulatory subunit 1 (p35)
sheep(101120847) cyclin-dependent kinase 5, regulatory subunit 1 (p35)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003885 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047541 MISSION® esiRNA esiRNA human CDK5R1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003885 Rosetta Predictions human pricing
NM_053891 Rosetta Predictions rat pricing
NM_009871 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193973 predicted 1329
2 SASI_Hs01_00193974 predicted 1153
3 SASI_Hs01_00193975 predicted 1293
4 SASI_Hs01_00193977 predicted 998
5 SASI_Hs01_00193978 predicted 1163
6 SASI_Hs01_00193979 predicted 1243
7 SASI_Hs01_00193980 predicted 1230
8 SASI_Hs01_00193981 predicted 628
9 SASI_Hs01_00193982 predicted 705
10 SASI_Hs02_00336497 predicted 1164
11 SASI_Hs01_00193976 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042897 predicted 957
2 SASI_Rn01_00042898 predicted 761
3 SASI_Rn02_00266811 predicted 873
4 SASI_Rn01_00042899 predicted 869
5 SASI_Rn01_00042900 predicted 888
6 SASI_Rn01_00042901 predicted 811
7 SASI_Rn02_00266812 predicted 920
8 SASI_Rn01_00042902 predicted 746
9 SASI_Rn02_00266813 predicted 919
10 SASI_Rn01_00042903 predicted 260
11 SASI_Rn01_00042904 predicted 780
12 SASI_Rn01_00042905 predicted 787
13 SASI_Rn01_00042906 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074592 predicted 1190
2 SASI_Mm01_00074593 predicted 1229
3 SASI_Mm01_00074594 predicted 684
4 SASI_Mm01_00074595 predicted 1808
5 SASI_Mm02_00317329 predicted 1146
6 SASI_Mm02_00317330 predicted 794
7 SASI_Mm01_00074596 predicted 1203
8 SASI_Mm01_00074597 predicted 872
9 SASI_Mm01_00074598 predicted 885
10 SASI_Mm01_00074599 predicted 729
11 SASI_Mm01_00074600 predicted 581
12 SASI_Mm01_00074601 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003885
VALIDATED
CDK5R1 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 5, regulatory subunit 1 (p35)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003885.2-494s1c1
Sequence:CCGGGTGCGCCAACCTGTCCACATTCTCGAGAATGTGGACAGGTTGGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197172    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003885.2-2212s1c1
Sequence:CCGGGCCGGATCTTGGAGACAATTACTCGAGTAATTGTCTCCAAGATCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003885.2-1058s1c1
Sequence:CCGGACACTACTTCACACAGGTCTTCTCGAGAAGACCTGTGTGAAGTAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003885.2-818s1c1
Sequence:CCGGCAACGTGGTCTTCCTCTACATCTCGAGATGTAGAGGAAGACCACGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003885.2-461s1c1
Sequence:CCGGCCTCAACAATGAGAACCTGAACTCGAGTTCAGGTTCTCATTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003885.2-3033s1c1
Sequence:CCGGCGTGTCTGTTTCCTTCTCTTTCTCGAGAAAGAGAAGGAAACAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003885.2-998s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003885.2-583s1c1
Sequence:CCGGGCTCCTCCTCAGTCAAGAAAGCTCGAGCTTTCTTGACTGAGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003885.2-296s1c1
Sequence:CCGGCCACTATACGGCCGTACAGAACTCGAGTTCTGTACGGCCGTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003885.2-3461s21c1
Sequence:CCGGGTAAACCTGGAGGGTTGATATCTCGAGATATCAACCCTCCAGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003885.2-1014s21c1
Sequence:CCGGATCAACCTCATGAGCTCAAAGCTCGAGCTTTGAGCTCATGAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003885.2-836s21c1
Sequence:CCGGCATGCTCTGCAGGGATGTTATCTCGAGATAACATCCCTGCAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003885.2-451s21c1
Sequence:CCGGACATCACGCACCTCAACAATGCTCGAGCATTGTTGAGGTGCGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003885.2-296s21c1
Sequence:CCGGCCACTATACGGCCGTACAGAACTCGAGTTCTGTACGGCCGTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003885
VALIDATED
CDK5R1 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 5, regulatory subunit 1 (p35)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003885.2-494s1c1
Sequence:CCGGGTGCGCCAACCTGTCCACATTCTCGAGAATGTGGACAGGTTGGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197172    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003885.2-2212s1c1
Sequence:CCGGGCCGGATCTTGGAGACAATTACTCGAGTAATTGTCTCCAAGATCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003885.2-1058s1c1
Sequence:CCGGACACTACTTCACACAGGTCTTCTCGAGAAGACCTGTGTGAAGTAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003885.2-818s1c1
Sequence:CCGGCAACGTGGTCTTCCTCTACATCTCGAGATGTAGAGGAAGACCACGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003885.2-461s1c1
Sequence:CCGGCCTCAACAATGAGAACCTGAACTCGAGTTCAGGTTCTCATTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003885.2-3033s1c1
Sequence:CCGGCGTGTCTGTTTCCTTCTCTTTCTCGAGAAAGAGAAGGAAACAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003885.2-998s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003885.2-583s1c1
Sequence:CCGGGCTCCTCCTCAGTCAAGAAAGCTCGAGCTTTCTTGACTGAGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003885.2-296s1c1
Sequence:CCGGCCACTATACGGCCGTACAGAACTCGAGTTCTGTACGGCCGTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003885.2-3461s21c1
Sequence:CCGGGTAAACCTGGAGGGTTGATATCTCGAGATATCAACCCTCCAGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003885.2-1014s21c1
Sequence:CCGGATCAACCTCATGAGCTCAAAGCTCGAGCTTTGAGCTCATGAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003885.2-836s21c1
Sequence:CCGGCATGCTCTGCAGGGATGTTATCTCGAGATAACATCCCTGCAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003885.2-451s21c1
Sequence:CCGGACATCACGCACCTCAACAATGCTCGAGCATTGTTGAGGTGCGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003885.2-296s21c1
Sequence:CCGGCCACTATACGGCCGTACAGAACTCGAGTTCTGTACGGCCGTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003885
VALIDATED
CDK5R1 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 5, regulatory subunit 1 (p35)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003885.2-494s1c1
Sequence:CCGGGTGCGCCAACCTGTCCACATTCTCGAGAATGTGGACAGGTTGGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197172    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003885.2-2212s1c1
Sequence:CCGGGCCGGATCTTGGAGACAATTACTCGAGTAATTGTCTCCAAGATCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003885.2-1058s1c1
Sequence:CCGGACACTACTTCACACAGGTCTTCTCGAGAAGACCTGTGTGAAGTAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003885.2-818s1c1
Sequence:CCGGCAACGTGGTCTTCCTCTACATCTCGAGATGTAGAGGAAGACCACGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003885.2-461s1c1
Sequence:CCGGCCTCAACAATGAGAACCTGAACTCGAGTTCAGGTTCTCATTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003885.2-3033s1c1
Sequence:CCGGCGTGTCTGTTTCCTTCTCTTTCTCGAGAAAGAGAAGGAAACAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003885.2-998s1c1
Sequence:UNK
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003885.2-583s1c1
Sequence:CCGGGCTCCTCCTCAGTCAAGAAAGCTCGAGCTTTCTTGACTGAGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003885.2-296s1c1
Sequence:CCGGCCACTATACGGCCGTACAGAACTCGAGTTCTGTACGGCCGTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003885.2-3461s21c1
Sequence:CCGGGTAAACCTGGAGGGTTGATATCTCGAGATATCAACCCTCCAGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003885.2-1014s21c1
Sequence:CCGGATCAACCTCATGAGCTCAAAGCTCGAGCTTTGAGCTCATGAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003885.2-836s21c1
Sequence:CCGGCATGCTCTGCAGGGATGTTATCTCGAGATAACATCCCTGCAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003885.2-451s21c1
Sequence:CCGGACATCACGCACCTCAACAATGCTCGAGCATTGTTGAGGTGCGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003885.2-296s21c1
Sequence:CCGGCCACTATACGGCCGTACAGAACTCGAGTTCTGTACGGCCGTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009871
CDK5R1 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 5, regulatory subunit 1 (p35)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009871.2-1990s1c1
Sequence:CCGGCCCACGTTAGTGCTGGTTAATCTCGAGATTAACCAGCACTAACGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009871.2-1295s1c1
Sequence:CCGGGACCCACACTATTTCACACAACTCGAGTTGTGTGAAATAGTGTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009871.2-1246s1c1
Sequence:CCGGCCTCTCAGTTATCAACCTCATCTCGAGATGAGGTTGATAACTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009871.2-1240s1c1
Sequence:CCGGCCGTTGCCTCTCAGTTATCAACTCGAGTTGATAACTGAGAGGCAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009871.2-697s1c1
Sequence:CCGGCGCGCATCTCAACAATGAGAACTCGAGTTCTCATTGTTGAGATGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009871.2-1044s21c1
Sequence:CCGGGTTTCATCACACCGGCCAATGCTCGAGCATTGGCCGGTGTGATGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009871.2-1668s21c1
Sequence:CCGGACGATGGATCCAGGGTAGATGCTCGAGCATCTACCCTGGATCCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009871
CDK5R1 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 5, regulatory subunit 1 (p35)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009871.2-1990s1c1
Sequence:CCGGCCCACGTTAGTGCTGGTTAATCTCGAGATTAACCAGCACTAACGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009871.2-1295s1c1
Sequence:CCGGGACCCACACTATTTCACACAACTCGAGTTGTGTGAAATAGTGTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009871.2-1246s1c1
Sequence:CCGGCCTCTCAGTTATCAACCTCATCTCGAGATGAGGTTGATAACTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009871.2-1240s1c1
Sequence:CCGGCCGTTGCCTCTCAGTTATCAACTCGAGTTGATAACTGAGAGGCAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009871.2-697s1c1
Sequence:CCGGCGCGCATCTCAACAATGAGAACTCGAGTTCTCATTGTTGAGATGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009871.2-1044s21c1
Sequence:CCGGGTTTCATCACACCGGCCAATGCTCGAGCATTGGCCGGTGTGATGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009871.2-1668s21c1
Sequence:CCGGACGATGGATCCAGGGTAGATGCTCGAGCATCTACCCTGGATCCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009871
CDK5R1 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 5, regulatory subunit 1 (p35)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009871.2-1990s1c1
Sequence:CCGGCCCACGTTAGTGCTGGTTAATCTCGAGATTAACCAGCACTAACGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009871.2-1295s1c1
Sequence:CCGGGACCCACACTATTTCACACAACTCGAGTTGTGTGAAATAGTGTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009871.2-1246s1c1
Sequence:CCGGCCTCTCAGTTATCAACCTCATCTCGAGATGAGGTTGATAACTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009871.2-1240s1c1
Sequence:CCGGCCGTTGCCTCTCAGTTATCAACTCGAGTTGATAACTGAGAGGCAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009871.2-697s1c1
Sequence:CCGGCGCGCATCTCAACAATGAGAACTCGAGTTCTCATTGTTGAGATGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009871.2-1044s21c1
Sequence:CCGGGTTTCATCACACCGGCCAATGCTCGAGCATTGGCCGGTGTGATGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009871.2-1668s21c1
Sequence:CCGGACGATGGATCCAGGGTAGATGCTCGAGCATCTACCCTGGATCCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks