EMAIL THIS PAGE TO A FRIEND

CDK5R2

cyclin-dependent kinase 5, regulatory subunit 2 (p39)

Synonyms: NCK5AI P39 p39nck5ai
UniProtKB ID: Q13319, Q4ZFW6
Gene ID:
Human(8941) Summary: The protein encoded by this gene is a neuron-specific activator of CDK5 kinase. It associates with CDK5 to form an active kinase. This protein and neuron-specific CDK5 activator CDK5R1/p39NCK5A both share limited similarity to cyclins, and thus may define a distinct family of cyclin-dependent kinase activating proteins. [provided by RefSeq, Jul 2008]
Mouse(12570) cyclin-dependent kinase 5, regulatory subunit 2 (p39)
Rat(501164) cyclin-dependent kinase 5, regulatory subunit 2 (p39)
chicken(100857507) cyclin-dependent kinase 5, regulatory subunit 2 (p39)
dog(488529) cyclin-dependent kinase 5, regulatory subunit 2 (p39)
cow(528533) cyclin-dependent kinase 5, regulatory subunit 2 (p39)
domestic cat(101099648) cyclin-dependent kinase 5, regulatory subunit 2 (p39)
sheep(101112037) cyclin-dependent kinase 5, regulatory subunit 2 (p39)
domestic guinea pig(100723895) cyclin-dependent kinase 5, regulatory subunit 2 (p39)
naked mole-rat(101698947) cyclin-dependent kinase 5, regulatory subunit 2 (p39)
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003936 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003936 Rosetta Predictions human pricing
NM_001109309 Rosetta Predictions rat pricing
NM_009872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056773 predicted 828
2 SASI_Hs01_00056774 predicted 825
3 SASI_Hs01_00056775 predicted 437
4 SASI_Hs01_00056776 predicted 840
5 SASI_Hs01_00056777 predicted 734
6 SASI_Hs01_00056778 predicted 713
7 SASI_Hs01_00056779 predicted 845
8 SASI_Hs01_00056780 predicted 808
9 SASI_Hs01_00056781 predicted 816
10 SASI_Hs01_00056782 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247154 predicted 839
2 SASI_Rn02_00247155 predicted 692
3 SASI_Rn02_00247156 predicted 294
4 SASI_Rn02_00247157 predicted 788
5 SASI_Rn02_00247158 predicted 586
6 SASI_Rn02_00247159 predicted 666
7 SASI_Rn02_00247160 predicted 567
8 SASI_Rn02_00247161 predicted 803
9 SASI_Rn02_00247162 predicted 796
10 SASI_Rn02_00247163 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116173 predicted 763
2 SASI_Mm01_00116180 predicted 898
3 SASI_Mm02_00317331 predicted 652
4 SASI_Mm02_00317332 predicted 1475
5 SASI_Mm02_00317333 predicted 976
6 SASI_Mm02_00317334 predicted 1664
7 SASI_Mm02_00317335 predicted 1257
8 SASI_Mm01_00116174 predicted 362
9 SASI_Mm02_00317336 predicted 637
10 SASI_Mm02_00317337 predicted 1408
11 SASI_Mm01_00116175 predicted 798
12 SASI_Mm01_00116176 predicted 573
13 SASI_Mm01_00116177 predicted 846
14 SASI_Mm01_00116178 predicted 533
15 SASI_Mm01_00116179 predicted 526
16 SASI_Mm01_00116181 predicted 578
17 SASI_Mm01_00116182 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009872
CDK5R2 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 5, regulatory subunit 2 (p39)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009872.3-1246s21c1
Sequence:CCGGATCAAGCCACCGTCGCTATTACTCGAGTAATAGCGACGGTGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009872.3-1016s21c1
Sequence:CCGGACTTCTTCACGCAAGTCTTTCCTCGAGGAAAGACTTGCGTGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009872.3-743s21c1
Sequence:CCGGGGCAAGACCAGGCCTTCATTACTCGAGTAATGAAGGCCTGGTCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009872.3-867s21c1
Sequence:CCGGCTACCTCGCCTACTCCTACATCTCGAGATGTAGGAGTAGGCGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009872.1-945s1c1
Sequence:CCGGCCACTTCTTCACGCAAGTCTTCTCGAGAAGACTTGCGTGAAGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009872.1-957s1c1
Sequence:CCGGGCAAGTCTTTCAAGACCTCAACTCGAGTTGAGGTCTTGAAAGACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009872.1-214s1c1
Sequence:CCGGGCCTCGGCCAAGAAGAAGAAACTCGAGTTTCTTCTTCTTGGCCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009872.1-699s1c1
Sequence:CCGGCGCCAACCTGGTGTTCGTGTACTCGAGTACACGAACACCAGGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009872
CDK5R2 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 5, regulatory subunit 2 (p39)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009872.3-1246s21c1
Sequence:CCGGATCAAGCCACCGTCGCTATTACTCGAGTAATAGCGACGGTGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009872.3-1016s21c1
Sequence:CCGGACTTCTTCACGCAAGTCTTTCCTCGAGGAAAGACTTGCGTGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009872.3-743s21c1
Sequence:CCGGGGCAAGACCAGGCCTTCATTACTCGAGTAATGAAGGCCTGGTCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009872.3-867s21c1
Sequence:CCGGCTACCTCGCCTACTCCTACATCTCGAGATGTAGGAGTAGGCGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009872.1-945s1c1
Sequence:CCGGCCACTTCTTCACGCAAGTCTTCTCGAGAAGACTTGCGTGAAGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009872.1-957s1c1
Sequence:CCGGGCAAGTCTTTCAAGACCTCAACTCGAGTTGAGGTCTTGAAAGACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009872.1-214s1c1
Sequence:CCGGGCCTCGGCCAAGAAGAAGAAACTCGAGTTTCTTCTTCTTGGCCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009872.1-699s1c1
Sequence:CCGGCGCCAACCTGGTGTTCGTGTACTCGAGTACACGAACACCAGGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009872
CDK5R2 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 5, regulatory subunit 2 (p39)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009872.3-1246s21c1
Sequence:CCGGATCAAGCCACCGTCGCTATTACTCGAGTAATAGCGACGGTGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009872.3-1016s21c1
Sequence:CCGGACTTCTTCACGCAAGTCTTTCCTCGAGGAAAGACTTGCGTGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009872.3-743s21c1
Sequence:CCGGGGCAAGACCAGGCCTTCATTACTCGAGTAATGAAGGCCTGGTCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009872.3-867s21c1
Sequence:CCGGCTACCTCGCCTACTCCTACATCTCGAGATGTAGGAGTAGGCGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009872.1-945s1c1
Sequence:CCGGCCACTTCTTCACGCAAGTCTTCTCGAGAAGACTTGCGTGAAGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009872.1-957s1c1
Sequence:CCGGGCAAGTCTTTCAAGACCTCAACTCGAGTTGAGGTCTTGAAAGACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009872.1-214s1c1
Sequence:CCGGGCCTCGGCCAAGAAGAAGAAACTCGAGTTTCTTCTTCTTGGCCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009872.1-699s1c1
Sequence:CCGGCGCCAACCTGGTGTTCGTGTACTCGAGTACACGAACACCAGGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003936
CDK5R2 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 5, regulatory subunit 2 (p39)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-1102s1c1
Sequence:CCGGGCAGGTCTTTCAAGACCTCAACTCGAGTTGAGGTCTTGAAAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-289s1c1
Sequence:CCGGCAAAGGCGAGAGCCGACTCAACTCGAGTTGAGTCGGCTCTCGCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-1091s1c1
Sequence:CCGGCACTTCTTCACGCAGGTCTTTCTCGAGAAAGACCTGCGTGAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-730s1c1
Sequence:CCGGCCGACGCTGCTATCGCCTCAACTCGAGTTGAGGCGATAGCAGCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-1212s1c1
Sequence:CCGGCCGGAACCAAGCACTGGACTACTCGAGTAGTCCAGTGCTTGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-703s1c1
Sequence:CCGGGCTGCGCTGTCTGGGCGACTTCTCGAGAAGTCGCCCAGACAGCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003936.3-1804s1c1
Sequence:CCGGCCTGTCATGTGTCACCATCTTCTCGAGAAGATGGTGACACATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-370s1c1
Sequence:CCGGGAAGAAGAAAGGCAGCAAGAACTCGAGTTCTTGCTGCCTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-970s1c1
Sequence:CCGGCGAGATCTCCTACCCACTCAACTCGAGTTGAGTGGGTAGGAGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-845s1c1
Sequence:CCGGGCAAACCTGGTGTTCGTGTACCTCGAGGTACACGAACACCAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003936
CDK5R2 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 5, regulatory subunit 2 (p39)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-1102s1c1
Sequence:CCGGGCAGGTCTTTCAAGACCTCAACTCGAGTTGAGGTCTTGAAAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-289s1c1
Sequence:CCGGCAAAGGCGAGAGCCGACTCAACTCGAGTTGAGTCGGCTCTCGCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-1091s1c1
Sequence:CCGGCACTTCTTCACGCAGGTCTTTCTCGAGAAAGACCTGCGTGAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-730s1c1
Sequence:CCGGCCGACGCTGCTATCGCCTCAACTCGAGTTGAGGCGATAGCAGCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-1212s1c1
Sequence:CCGGCCGGAACCAAGCACTGGACTACTCGAGTAGTCCAGTGCTTGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-703s1c1
Sequence:CCGGGCTGCGCTGTCTGGGCGACTTCTCGAGAAGTCGCCCAGACAGCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003936.3-1804s1c1
Sequence:CCGGCCTGTCATGTGTCACCATCTTCTCGAGAAGATGGTGACACATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-370s1c1
Sequence:CCGGGAAGAAGAAAGGCAGCAAGAACTCGAGTTCTTGCTGCCTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-970s1c1
Sequence:CCGGCGAGATCTCCTACCCACTCAACTCGAGTTGAGTGGGTAGGAGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-845s1c1
Sequence:CCGGGCAAACCTGGTGTTCGTGTACCTCGAGGTACACGAACACCAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003936
CDK5R2 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 5, regulatory subunit 2 (p39)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-1102s1c1
Sequence:CCGGGCAGGTCTTTCAAGACCTCAACTCGAGTTGAGGTCTTGAAAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-289s1c1
Sequence:CCGGCAAAGGCGAGAGCCGACTCAACTCGAGTTGAGTCGGCTCTCGCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-1091s1c1
Sequence:CCGGCACTTCTTCACGCAGGTCTTTCTCGAGAAAGACCTGCGTGAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-730s1c1
Sequence:CCGGCCGACGCTGCTATCGCCTCAACTCGAGTTGAGGCGATAGCAGCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-1212s1c1
Sequence:CCGGCCGGAACCAAGCACTGGACTACTCGAGTAGTCCAGTGCTTGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-703s1c1
Sequence:CCGGGCTGCGCTGTCTGGGCGACTTCTCGAGAAGTCGCCCAGACAGCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003936.3-1804s1c1
Sequence:CCGGCCTGTCATGTGTCACCATCTTCTCGAGAAGATGGTGACACATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-370s1c1
Sequence:CCGGGAAGAAGAAAGGCAGCAAGAACTCGAGTTCTTGCTGCCTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-970s1c1
Sequence:CCGGCGAGATCTCCTACCCACTCAACTCGAGTTGAGTGGGTAGGAGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003936.3-845s1c1
Sequence:CCGGGCAAACCTGGTGTTCGTGTACCTCGAGGTACACGAACACCAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks