EMAIL THIS PAGE TO A FRIEND

CDK5RAP1

CDK5 regulatory subunit associated protein 1

91 Gene Product Result for
Synonyms: C20orf34 C42 CGI-05 HSPC167
Gene ID:
Human(51654) Summary: This gene encodes a regulator of cyclin-dependent kinase 5 activity. This protein has also been reported to modify RNA by adding a methylthio-group and may thus have a dual function as an RNA methylthiotransferase and as an inhibitor of cyclin-dependent kinase 5 activity. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]
Mouse(66971) CDK5 regulatory subunit associated protein 1
Rat(252827) CDK5 regulatory subunit associated protein 1
chicken(419292) CDK5 regulatory subunit associated protein 1
dog(477195) CDK5 regulatory subunit associated protein 1
cow(514086) CDK5 regulatory subunit associated protein 1
Horse(100054149) CDK5 regulatory subunit associated protein 1
domestic cat(101091009) CDK5 regulatory subunit associated protein 1
naked mole-rat(101721598) CDK5 regulatory subunit associated protein 1
domestic guinea pig(100717821) CDK5 regulatory subunit associated protein 1
sheep(101109200) CDK5 regulatory subunit associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016082 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016082 Rosetta Predictions human pricing
NM_016408 Rosetta Predictions human pricing
NM_145721 Rosetta Predictions rat pricing
NM_025876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051887 predicted 1197
2 SASI_Hs01_00051888 predicted 948
3 SASI_Hs02_00348833 predicted 542
4 SASI_Hs01_00051889 predicted 380
5 SASI_Hs01_00051890 predicted 1190
6 SASI_Hs01_00051891 predicted 1204
7 SASI_Hs01_00051892 predicted 1248
8 SASI_Hs01_00051893 predicted 530
9 SASI_Hs01_00051895 predicted 1363
10 SASI_Hs01_00051896 predicted 676
11 SASI_Hs01_00051894 predicted 1718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066687 predicted 1347
2 SASI_Hs01_00066688 predicted 1091
3 SASI_Hs02_00349431 predicted 685
4 SASI_Hs01_00066689 predicted 530
5 SASI_Hs01_00066690 predicted 1338
6 SASI_Hs01_00066691 predicted 1359
7 SASI_Hs01_00066692 predicted 1394
8 SASI_Hs01_00066693 predicted 681
9 SASI_Hs01_00066695 predicted 1510
10 SASI_Hs01_00066696 predicted 829
11 SASI_Hs01_00066694 predicted 1867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059040 predicted 994
2 SASI_Rn01_00059041 predicted 732
3 SASI_Rn01_00059044 predicted 587
4 SASI_Rn02_00268739 predicted 1237
5 SASI_Rn01_00059045 predicted 913
6 SASI_Rn01_00059046 predicted 802
7 SASI_Rn02_00268740 predicted 1437
8 SASI_Rn01_00059047 predicted 345
9 SASI_Rn02_00268741 predicted 1531
10 SASI_Rn01_00059048 predicted 764
11 SASI_Rn01_00059039 predicted 1772
12 SASI_Rn01_00059042 predicted 1162
13 SASI_Rn01_00059043 predicted 1748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076511 predicted 757
2 SASI_Mm01_00076512 predicted 374
3 SASI_Mm01_00076513 predicted 1301
4 SASI_Mm01_00076514 predicted 1184
5 SASI_Mm01_00076515 predicted 1473
6 SASI_Mm02_00329202 predicted 467
7 SASI_Mm01_00076516 predicted 1446
8 SASI_Mm01_00076518 predicted 1265
9 SASI_Mm01_00076519 predicted 1389
10 SASI_Mm01_00076520 predicted 1598
11 SASI_Mm01_00076517 predicted 1717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025876
VALIDATED
CDK5RAP1 MISSION shRNA Bacterial Glycerol Stock
CDK5 regulatory subunit associated protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025876.1-1271s1c1
Sequence:CCGGGAAGCATATGTGGCATTAGTTCTCGAGAACTAATGCCACATATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025876.1-721s1c1
Sequence:CCGGGCAAGCAGCAAATGTGCTTCTCTCGAGAGAAGCACATTTGCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025876.1-523s1c1
Sequence:CCGGGAACCGCTTACATCAGCTCAACTCGAGTTGAGCTGATGTAAGCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025876.2-1246s21c1
Sequence:CCGGTGCCATGCGGAGAGGATATTCCTCGAGGAATATCCTCTCCGCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025876.2-984s21c1
Sequence:CCGGATTCGGAAGTCCAGTTCAATACTCGAGTATTGAACTGGACTTCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025876.2-799s21c1
Sequence:CCGGTTCTGCCTTTGTATCCATTATCTCGAGATAATGGATACAAAGGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025876.2-1031s21c1
Sequence:CCGGGGCTTTACCACCAACTATAAACTCGAGTTTATAGTTGGTGGTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025876.2-748s21c1
Sequence:CCGGGGATGAGACCTACGCAGATATCTCGAGATATCTGCGTAGGTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025876
VALIDATED
CDK5RAP1 MISSION shRNA shRNA Plasmid DNA
CDK5 regulatory subunit associated protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025876.1-1271s1c1
Sequence:CCGGGAAGCATATGTGGCATTAGTTCTCGAGAACTAATGCCACATATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025876.1-721s1c1
Sequence:CCGGGCAAGCAGCAAATGTGCTTCTCTCGAGAGAAGCACATTTGCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025876.1-523s1c1
Sequence:CCGGGAACCGCTTACATCAGCTCAACTCGAGTTGAGCTGATGTAAGCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025876.2-1246s21c1
Sequence:CCGGTGCCATGCGGAGAGGATATTCCTCGAGGAATATCCTCTCCGCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025876.2-984s21c1
Sequence:CCGGATTCGGAAGTCCAGTTCAATACTCGAGTATTGAACTGGACTTCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025876.2-799s21c1
Sequence:CCGGTTCTGCCTTTGTATCCATTATCTCGAGATAATGGATACAAAGGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025876.2-1031s21c1
Sequence:CCGGGGCTTTACCACCAACTATAAACTCGAGTTTATAGTTGGTGGTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025876.2-748s21c1
Sequence:CCGGGGATGAGACCTACGCAGATATCTCGAGATATCTGCGTAGGTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025876
VALIDATED
CDK5RAP1 MISSION shRNA Lentiviral Transduction Particles
CDK5 regulatory subunit associated protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025876.1-1271s1c1
Sequence:CCGGGAAGCATATGTGGCATTAGTTCTCGAGAACTAATGCCACATATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025876.1-721s1c1
Sequence:CCGGGCAAGCAGCAAATGTGCTTCTCTCGAGAGAAGCACATTTGCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025876.1-523s1c1
Sequence:CCGGGAACCGCTTACATCAGCTCAACTCGAGTTGAGCTGATGTAAGCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025876.2-1246s21c1
Sequence:CCGGTGCCATGCGGAGAGGATATTCCTCGAGGAATATCCTCTCCGCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025876.2-984s21c1
Sequence:CCGGATTCGGAAGTCCAGTTCAATACTCGAGTATTGAACTGGACTTCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025876.2-799s21c1
Sequence:CCGGTTCTGCCTTTGTATCCATTATCTCGAGATAATGGATACAAAGGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025876.2-1031s21c1
Sequence:CCGGGGCTTTACCACCAACTATAAACTCGAGTTTATAGTTGGTGGTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025876.2-748s21c1
Sequence:CCGGGGATGAGACCTACGCAGATATCTCGAGATATCTGCGTAGGTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016082
VALIDATED
CDK5RAP1 MISSION shRNA Bacterial Glycerol Stock
CDK5 regulatory subunit associated protein 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-1201s1c1
Sequence:CCGGGTGGAGTTAGTTCACCATATTCTCGAGAATATGGTGAACTAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-672s1c1
Sequence:CCGGCGAGACCTATGCTGATGTCATCTCGAGATGACATCAGCATAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-1317s1c1
Sequence:CCGGCCGGGAAGTTCAGTACAACATCTCGAGATGTTGTACTGAACTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-444s1c1
Sequence:CCGGGAACCGTTTACATCAGCTTAACTCGAGTTAAGCTGATGTAAACGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-938s1c1
Sequence:CCGGCCAATCTCAGTCGTGGCTTTACTCGAGTAAAGCCACGACTGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016082.3-1294s21c1
Sequence:CCGGCACGTCCAGACAGTCTCTTTGCTCGAGCAAAGAGACTGTCTGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_016082.3-446s21c1
Sequence:CCGGACCGTTTACATCAGCTTAAAGCTCGAGCTTTAAGCTGATGTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016082.3-1202s21c1
Sequence:CCGGTGGAGTTAGTTCACCATATTACTCGAGTAATATGGTGAACTAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016082.3-1756s21c1
Sequence:CCGGTCAGAGCTGACTTGGGCAATCCTCGAGGATTGCCCAAGTCAGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016082.3-1239s21c1
Sequence:CCGGTGTGAGCCTCAGCAGCGATTTCTCGAGAAATCGCTGCTGAGGCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_016082.3-952s21c1
Sequence:CCGGGGCTTTACCACCAACTATAAACTCGAGTTTATAGTTGGTGGTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016082.3-718s21c1
Sequence:CCGGACGTCTGCCTTTGTGTCAATCCTCGAGGATTGACACAAAGGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016082.3-1364s21c1
Sequence:CCGGGACAGAAGACACGGGCATATCCTCGAGGATATGCCCGTGTCTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016082
VALIDATED
CDK5RAP1 MISSION shRNA shRNA Plasmid DNA
CDK5 regulatory subunit associated protein 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-1201s1c1
Sequence:CCGGGTGGAGTTAGTTCACCATATTCTCGAGAATATGGTGAACTAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-672s1c1
Sequence:CCGGCGAGACCTATGCTGATGTCATCTCGAGATGACATCAGCATAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-1317s1c1
Sequence:CCGGCCGGGAAGTTCAGTACAACATCTCGAGATGTTGTACTGAACTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-444s1c1
Sequence:CCGGGAACCGTTTACATCAGCTTAACTCGAGTTAAGCTGATGTAAACGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-938s1c1
Sequence:CCGGCCAATCTCAGTCGTGGCTTTACTCGAGTAAAGCCACGACTGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016082.3-1294s21c1
Sequence:CCGGCACGTCCAGACAGTCTCTTTGCTCGAGCAAAGAGACTGTCTGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_016082.3-446s21c1
Sequence:CCGGACCGTTTACATCAGCTTAAAGCTCGAGCTTTAAGCTGATGTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016082.3-1202s21c1
Sequence:CCGGTGGAGTTAGTTCACCATATTACTCGAGTAATATGGTGAACTAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016082.3-1756s21c1
Sequence:CCGGTCAGAGCTGACTTGGGCAATCCTCGAGGATTGCCCAAGTCAGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016082.3-1239s21c1
Sequence:CCGGTGTGAGCCTCAGCAGCGATTTCTCGAGAAATCGCTGCTGAGGCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_016082.3-952s21c1
Sequence:CCGGGGCTTTACCACCAACTATAAACTCGAGTTTATAGTTGGTGGTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016082.3-718s21c1
Sequence:CCGGACGTCTGCCTTTGTGTCAATCCTCGAGGATTGACACAAAGGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016082.3-1364s21c1
Sequence:CCGGGACAGAAGACACGGGCATATCCTCGAGGATATGCCCGTGTCTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016082
VALIDATED
CDK5RAP1 MISSION shRNA Lentiviral Transduction Particles
CDK5 regulatory subunit associated protein 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-1201s1c1
Sequence:CCGGGTGGAGTTAGTTCACCATATTCTCGAGAATATGGTGAACTAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-672s1c1
Sequence:CCGGCGAGACCTATGCTGATGTCATCTCGAGATGACATCAGCATAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-1317s1c1
Sequence:CCGGCCGGGAAGTTCAGTACAACATCTCGAGATGTTGTACTGAACTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-444s1c1
Sequence:CCGGGAACCGTTTACATCAGCTTAACTCGAGTTAAGCTGATGTAAACGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_016082.3-938s1c1
Sequence:CCGGCCAATCTCAGTCGTGGCTTTACTCGAGTAAAGCCACGACTGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016082.3-1294s21c1
Sequence:CCGGCACGTCCAGACAGTCTCTTTGCTCGAGCAAAGAGACTGTCTGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_016082.3-446s21c1
Sequence:CCGGACCGTTTACATCAGCTTAAAGCTCGAGCTTTAAGCTGATGTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016082.3-1202s21c1
Sequence:CCGGTGGAGTTAGTTCACCATATTACTCGAGTAATATGGTGAACTAACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016082.3-1756s21c1
Sequence:CCGGTCAGAGCTGACTTGGGCAATCCTCGAGGATTGCCCAAGTCAGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016082.3-1239s21c1
Sequence:CCGGTGTGAGCCTCAGCAGCGATTTCTCGAGAAATCGCTGCTGAGGCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_016082.3-952s21c1
Sequence:CCGGGGCTTTACCACCAACTATAAACTCGAGTTTATAGTTGGTGGTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016082.3-718s21c1
Sequence:CCGGACGTCTGCCTTTGTGTCAATCCTCGAGGATTGACACAAAGGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016082.3-1364s21c1
Sequence:CCGGGACAGAAGACACGGGCATATCCTCGAGGATATGCCCGTGTCTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks