EMAIL THIS PAGE TO A FRIEND

CDK5RAP2

CDK5 regulatory subunit associated protein 2

178 Gene Product Result for
Synonyms: C48 Cep215 MCPH3
Gene ID:
Human(55755) Summary: This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Mouse(214444) CDK5 regulatory subunit associated protein 2
Rat(286919) CDK5 regulatory subunit associated protein 2
sheep(101116809) CDK5 regulatory subunit associated protein 2
domestic guinea pig(100734402) CDK5 regulatory subunit associated protein 2
naked mole-rat(101713341) CDK5 regulatory subunit associated protein 2
chicken(771445) CDK5 regulatory subunit associated protein 2
dog(612705) CDK5 regulatory subunit associated protein 2
cow(508100) CDK5 regulatory subunit associated protein 2
Horse(100071839) CDK5 regulatory subunit associated protein 2
domestic cat(101085931) CDK5 regulatory subunit associated protein 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018249 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059391 MISSION® esiRNA esiRNA human CDK5RAP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011649 Rosetta Predictions human pricing
NM_018249 Rosetta Predictions human pricing
XM_001058949 Rosetta Predictions rat pricing
XM_001059003 Rosetta Predictions rat pricing
XM_001059053 Rosetta Predictions rat pricing
XM_001059116 Rosetta Predictions rat pricing
XM_575844 Rosetta Predictions rat pricing
NM_145990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224003 predicted 402
2 SASI_Hs02_00306000 predicted 4563
3 SASI_Hs01_00224004 predicted 5135
4 SASI_Hs02_00306001 predicted 2356
5 SASI_Hs01_00224005 predicted 4379
6 SASI_Hs01_00224006 predicted 3897
7 SASI_Hs02_00306002 predicted 5690
8 SASI_Hs01_00224007 predicted 1139
9 SASI_Hs01_00224009 predicted 2517
10 SASI_Hs01_00224010 predicted 1629
11 SASI_Hs01_00224008 predicted 573
12 SASI_Hs01_00224011 predicted 3322
13 SASI_Hs01_00224012 predicted 5694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104081 predicted 402
2 SASI_Hs02_00351601 predicted 4564
3 SASI_Hs01_00104082 predicted 5375
4 SASI_Hs02_00351602 predicted 2361
5 SASI_Hs01_00104083 predicted 4378
6 SASI_Hs01_00104084 predicted 3898
7 SASI_Hs02_00351603 predicted 5932
8 SASI_Hs01_00104085 predicted 1143
9 SASI_Hs01_00104087 predicted 2518
10 SASI_Hs01_00104088 predicted 1628
11 SASI_Hs01_00104086 predicted 565
12 SASI_Hs01_00104089 predicted 3322
13 SASI_Hs01_00104090 predicted 5927
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291363 predicted 509
2 SASI_Rn02_00291364 predicted 2320
3 SASI_Rn02_00291365 predicted 2602
4 SASI_Rn02_00291366 predicted 3954
5 SASI_Rn02_00291367 predicted 1665
6 SASI_Rn02_00291368 predicted 4840
7 SASI_Rn02_00291369 predicted 5366
8 SASI_Rn02_00291370 predicted 5157
9 SASI_Rn02_00291371 predicted 1838
10 SASI_Rn02_00291372 predicted 3108
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291594 predicted 1899
2 SASI_Rn02_00291595 predicted 2172
3 SASI_Rn02_00291596 predicted 3539
4 SASI_Rn02_00291597 predicted 1237
5 SASI_Rn02_00291598 predicted 4430
6 SASI_Rn02_00291599 predicted 4720
7 SASI_Rn02_00291600 predicted 4510
8 SASI_Rn02_00291601 predicted 1417
9 SASI_Rn02_00291602 predicted 2691
10 SASI_Rn02_00291603 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291758 predicted 512
2 SASI_Rn02_00291759 predicted 2321
3 SASI_Rn02_00291760 predicted 2595
4 SASI_Rn02_00291761 predicted 3957
5 SASI_Rn02_00291762 predicted 1665
6 SASI_Rn02_00291763 predicted 4836
7 SASI_Rn02_00291764 predicted 5128
8 SASI_Rn02_00291765 predicted 4924
9 SASI_Rn02_00291766 predicted 1832
10 SASI_Rn02_00291767 predicted 3109
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292034 predicted 510
2 SASI_Rn02_00292035 predicted 2320
3 SASI_Rn02_00292036 predicted 2592
4 SASI_Rn02_00292037 predicted 3967
5 SASI_Rn02_00292038 predicted 1660
6 SASI_Rn02_00292039 predicted 4847
7 SASI_Rn02_00292040 predicted 5143
8 SASI_Rn02_00292041 predicted 4938
9 SASI_Rn02_00292042 predicted 1833
10 SASI_Rn02_00292043 predicted 3109
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404434 predicted 5551
2 SASI_Rn02_00404435 predicted 5602
3 SASI_Rn02_00404436 predicted 5608
4 SASI_Rn02_00404437 predicted 5598
5 SASI_Rn02_00404438 predicted 5617
6 SASI_Rn02_00404439 predicted 5600
7 SASI_Rn02_00404440 predicted 5596
8 SASI_Rn02_00404441 predicted 5555
9 SASI_Rn02_00404442 predicted 5623
10 SASI_Rn02_00404443 predicted 5597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173816 predicted 3258
2 SASI_Mm01_00173818 predicted 388
3 SASI_Mm02_00341503 predicted 4790
4 SASI_Mm01_00173819 predicted 4870
5 SASI_Mm01_00173820 predicted 5078
6 SASI_Mm01_00173821 predicted 2203
7 SASI_Mm01_00173822 predicted 3828
8 SASI_Mm02_00341504 predicted 3631
9 SASI_Mm02_00341505 predicted 4912
10 SASI_Mm02_00341506 predicted 3637
11 SASI_Mm01_00173815 predicted 3644
12 SASI_Mm01_00173817 predicted 1928
13 SASI_Mm01_00173823 predicted 2259
14 SASI_Mm01_00173824 predicted 3829
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145990
VALIDATED
CDK5RAP2 MISSION shRNA Bacterial Glycerol Stock
CDK5 regulatory subunit associated protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145990.3-388s21c1
Sequence:CCGGGCACATCTACAAGACGAACATCTCGAGATGTTCGTCTTGTAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145990.3-4292s21c1
Sequence:CCGGCCTCAAGACTTACTAATGGAACTCGAGTTCCATTAGTAAGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145990.3-3829s21c1
Sequence:CCGGGCCATCAAGATACGATTCATTCTCGAGAATGAATCGTATCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145990.3-2273s21c1
Sequence:CCGGCGTGAGATCATGGAGGACTATCTCGAGATAGTCCTCCATGATCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145990.2-2273s1c1
Sequence:CCGGCGTGAGATCATGGAGGACTATCTCGAGATAGTCCTCCATGATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145990.2-4292s1c1
Sequence:CCGGCCTCAAGACTTACTAATGGAACTCGAGTTCCATTAGTAAGTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145990.2-388s1c1
Sequence:CCGGGCACATCTACAAGACGAACATCTCGAGATGTTCGTCTTGTAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145990.2-3829s1c1
Sequence:CCGGGCCATCAAGATACGATTCATTCTCGAGAATGAATCGTATCTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145990
VALIDATED
CDK5RAP2 MISSION shRNA shRNA Plasmid DNA
CDK5 regulatory subunit associated protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145990.3-388s21c1
Sequence:CCGGGCACATCTACAAGACGAACATCTCGAGATGTTCGTCTTGTAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145990.3-4292s21c1
Sequence:CCGGCCTCAAGACTTACTAATGGAACTCGAGTTCCATTAGTAAGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145990.3-3829s21c1
Sequence:CCGGGCCATCAAGATACGATTCATTCTCGAGAATGAATCGTATCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145990.3-2273s21c1
Sequence:CCGGCGTGAGATCATGGAGGACTATCTCGAGATAGTCCTCCATGATCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145990.2-2273s1c1
Sequence:CCGGCGTGAGATCATGGAGGACTATCTCGAGATAGTCCTCCATGATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145990.2-4292s1c1
Sequence:CCGGCCTCAAGACTTACTAATGGAACTCGAGTTCCATTAGTAAGTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145990.2-388s1c1
Sequence:CCGGGCACATCTACAAGACGAACATCTCGAGATGTTCGTCTTGTAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145990.2-3829s1c1
Sequence:CCGGGCCATCAAGATACGATTCATTCTCGAGAATGAATCGTATCTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145990
VALIDATED
CDK5RAP2 MISSION shRNA Lentiviral Transduction Particles
CDK5 regulatory subunit associated protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145990.3-388s21c1
Sequence:CCGGGCACATCTACAAGACGAACATCTCGAGATGTTCGTCTTGTAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145990.3-4292s21c1
Sequence:CCGGCCTCAAGACTTACTAATGGAACTCGAGTTCCATTAGTAAGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145990.3-3829s21c1
Sequence:CCGGGCCATCAAGATACGATTCATTCTCGAGAATGAATCGTATCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145990.3-2273s21c1
Sequence:CCGGCGTGAGATCATGGAGGACTATCTCGAGATAGTCCTCCATGATCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145990.2-2273s1c1
Sequence:CCGGCGTGAGATCATGGAGGACTATCTCGAGATAGTCCTCCATGATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145990.2-4292s1c1
Sequence:CCGGCCTCAAGACTTACTAATGGAACTCGAGTTCCATTAGTAAGTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145990.2-388s1c1
Sequence:CCGGGCACATCTACAAGACGAACATCTCGAGATGTTCGTCTTGTAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145990.2-3829s1c1
Sequence:CCGGGCCATCAAGATACGATTCATTCTCGAGAATGAATCGTATCTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018249
CDK5RAP2 MISSION shRNA Bacterial Glycerol Stock
CDK5 regulatory subunit associated protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018249.4-5925s21c1
Sequence:CCGGCCAAGTGTGGTTCCTATTTATCTCGAGATAAATAGGAACCACACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018249.4-4402s21c1
Sequence:CCGGGCGTTTAGAAGAATCTATTAACTCGAGTTAATAGATTCTTCTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018249.4-3594s21c1
Sequence:CCGGAGTGCAGTGAGGCCATAATTACTCGAGTAATTATGGCCTCACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018249.4-1734s21c1
Sequence:CCGGTCAGGAGTGAAGGCTTAATAACTCGAGTTATTAAGCCTTCACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018249.4-1116s21c1
Sequence:CCGGATAGTCTAAAGAGGGATAAAGCTCGAGCTTTATCCCTCTTTAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-399s1c1
Sequence:CCGGCGCATCTATTTCCTTGAGGAACTCGAGTTCCTCAAGGAAATAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-2348s1c1
Sequence:CCGGGCAGCAGAGTAATGAGATTATCTCGAGATAATCTCATTACTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-4234s1c1
Sequence:CCGGCGCTCTCTGATTATGAAACATCTCGAGATGTTTCATAATCAGAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-1577s1c1
Sequence:CCGGGCACAATCAAGAGCAAGTGATCTCGAGATCACTTGCTCTTGATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-5403s1c1
Sequence:CCGGCTTGCTGAAATGGACATTCAACTCGAGTTGAATGTCCATTTCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018249
CDK5RAP2 MISSION shRNA shRNA Plasmid DNA
CDK5 regulatory subunit associated protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018249.4-5925s21c1
Sequence:CCGGCCAAGTGTGGTTCCTATTTATCTCGAGATAAATAGGAACCACACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018249.4-4402s21c1
Sequence:CCGGGCGTTTAGAAGAATCTATTAACTCGAGTTAATAGATTCTTCTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018249.4-3594s21c1
Sequence:CCGGAGTGCAGTGAGGCCATAATTACTCGAGTAATTATGGCCTCACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018249.4-1734s21c1
Sequence:CCGGTCAGGAGTGAAGGCTTAATAACTCGAGTTATTAAGCCTTCACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018249.4-1116s21c1
Sequence:CCGGATAGTCTAAAGAGGGATAAAGCTCGAGCTTTATCCCTCTTTAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-399s1c1
Sequence:CCGGCGCATCTATTTCCTTGAGGAACTCGAGTTCCTCAAGGAAATAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-2348s1c1
Sequence:CCGGGCAGCAGAGTAATGAGATTATCTCGAGATAATCTCATTACTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-4234s1c1
Sequence:CCGGCGCTCTCTGATTATGAAACATCTCGAGATGTTTCATAATCAGAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-1577s1c1
Sequence:CCGGGCACAATCAAGAGCAAGTGATCTCGAGATCACTTGCTCTTGATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-5403s1c1
Sequence:CCGGCTTGCTGAAATGGACATTCAACTCGAGTTGAATGTCCATTTCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018249
CDK5RAP2 MISSION shRNA Lentiviral Transduction Particles
CDK5 regulatory subunit associated protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018249.4-5925s21c1
Sequence:CCGGCCAAGTGTGGTTCCTATTTATCTCGAGATAAATAGGAACCACACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018249.4-4402s21c1
Sequence:CCGGGCGTTTAGAAGAATCTATTAACTCGAGTTAATAGATTCTTCTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018249.4-3594s21c1
Sequence:CCGGAGTGCAGTGAGGCCATAATTACTCGAGTAATTATGGCCTCACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018249.4-1734s21c1
Sequence:CCGGTCAGGAGTGAAGGCTTAATAACTCGAGTTATTAAGCCTTCACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018249.4-1116s21c1
Sequence:CCGGATAGTCTAAAGAGGGATAAAGCTCGAGCTTTATCCCTCTTTAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-399s1c1
Sequence:CCGGCGCATCTATTTCCTTGAGGAACTCGAGTTCCTCAAGGAAATAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-2348s1c1
Sequence:CCGGGCAGCAGAGTAATGAGATTATCTCGAGATAATCTCATTACTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-4234s1c1
Sequence:CCGGCGCTCTCTGATTATGAAACATCTCGAGATGTTTCATAATCAGAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-1577s1c1
Sequence:CCGGGCACAATCAAGAGCAAGTGATCTCGAGATCACTTGCTCTTGATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018249.3-5403s1c1
Sequence:CCGGCTTGCTGAAATGGACATTCAACTCGAGTTGAATGTCCATTTCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks