EMAIL THIS PAGE TO A FRIEND

CDK5RAP3

CDK5 regulatory subunit associated protein 3

Synonyms: C53 HSF-27 IC53 LZAP MST016 OK/SW-cl.114 PP1553
Gene ID:
Human(80279) Summary: This gene encodes a protein that has been reported to function in signaling pathways governing transcriptional regulation and cell cycle progression. It may play a role in tumorigenesis and metastasis. A pseudogene of this gene is located on the long arm of chromosome 20. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]
Mouse(80280) CDK5 regulatory subunit associated protein 3
Rat(80278) CDK5 regulatory subunit associated protein 3
Zebrafish(415195) CDK5 regulatory subunit associated protein 3
chicken(430350) CDK5 regulatory subunit associated protein 3
cow(509255) CDK5 regulatory subunit associated protein 3
domestic cat(101084753) CDK5 regulatory subunit associated protein 3
dog(480541) CDK5 regulatory subunit associated protein 3
naked mole-rat(101702706) CDK5 regulatory subunit associated protein 3
domestic guinea pig(100721047) CDK5 regulatory subunit associated protein 3
sheep(101116665) CDK5 regulatory subunit associated protein 3
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025197 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176096 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025197 Rosetta Predictions human pricing
NM_176095 Rosetta Predictions human pricing
NM_176096 Rosetta Predictions human pricing
NM_024488 Rosetta Predictions rat pricing
NM_030248 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177479 predicted 537
2 SASI_Hs01_00177480 predicted 776
3 SASI_Hs01_00177481 predicted 460
4 SASI_Hs01_00177482 predicted 371
5 SASI_Hs01_00177483 predicted 748
6 SASI_Hs01_00177484 predicted 662
7 SASI_Hs01_00177485 predicted 788
8 SASI_Hs01_00177486 predicted 265
9 SASI_Hs01_00177487 predicted 169
10 SASI_Hs01_00177488 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177857 predicted 543
2 SASI_Hs01_00177858 predicted 774
3 SASI_Hs01_00177859 predicted 461
4 SASI_Hs01_00177860 predicted 365
5 SASI_Hs01_00177861 predicted 748
6 SASI_Hs01_00177862 predicted 663
7 SASI_Hs01_00177863 predicted 792
8 SASI_Hs01_00177864 predicted 266
9 SASI_Hs01_00177865 predicted 159
10 SASI_Hs01_00177866 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369200 predicted 1544
2 SASI_Hs01_00143361 predicted 968
3 SASI_Hs01_00143362 predicted 1355
4 SASI_Hs02_00369201 predicted 1378
5 SASI_Hs01_00143368 predicted 1294
6 SASI_Hs02_00369202 predicted 1613
7 SASI_Hs02_00369203 predicted 273
8 SASI_Hs02_00369204 predicted 1361
9 SASI_Hs02_00369205 predicted 780
10 SASI_Hs02_00369206 predicted 288
11 SASI_Hs01_00143360 predicted 1658
12 SASI_Hs01_00143363 predicted 1321
13 SASI_Hs01_00143364 predicted 1127
14 SASI_Hs01_00143365 predicted 1490
15 SASI_Hs01_00143366 predicted 1602
16 SASI_Hs01_00143367 predicted 1607
17 SASI_Hs01_00143369 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059414 predicted 597
2 SASI_Rn01_00059415 predicted 765
3 SASI_Rn01_00059416 predicted 269
4 SASI_Rn01_00059417 predicted 963
5 SASI_Rn02_00264025 predicted 1152
6 SASI_Rn01_00059418 predicted 1121
7 SASI_Rn02_00264026 predicted 887
8 SASI_Rn01_00059419 predicted 1535
9 SASI_Rn01_00059420 predicted 364
10 SASI_Rn01_00059421 predicted 558
11 SASI_Rn01_00059422 predicted 790
12 SASI_Rn01_00059423 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336712 predicted 955
2 SASI_Mm01_00031594 predicted 785
3 SASI_Mm01_00031595 predicted 651
4 SASI_Mm02_00336713 predicted 1162
5 SASI_Mm01_00031596 predicted 1356
6 SASI_Mm02_00336714 predicted 601
7 SASI_Mm02_00336715 predicted 550
8 SASI_Mm01_00031598 predicted 410
9 SASI_Mm01_00031599 predicted 925
10 SASI_Mm01_00031600 predicted 615
11 SASI_Mm01_00031593 predicted 355
12 SASI_Mm01_00031597 predicted 360
13 SASI_Mm01_00031601 predicted 1362
14 SASI_Mm01_00031602 predicted 1564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030248
CDK5RAP3 MISSION shRNA Bacterial Glycerol Stock
CDK5 regulatory subunit associated protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030248.1-1532s1c1
Sequence:CCGGGAAACTGATTGAAGCCGACATCTCGAGATGTCGGCTTCAATCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030248.1-1125s1c1
Sequence:CCGGGAAACTCGGAATCAGTTCATTCTCGAGAATGAACTGATTCCGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030248.1-158s1c1
Sequence:CCGGCAGAAGACACTGTAACCTAAACTCGAGTTTAGGTTACAGTGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030248.1-405s1c1
Sequence:CCGGGAGAAGGACAACACCTATTTACTCGAGTAAATAGGTGTTGTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030248.1-405s21c1
Sequence:CCGGGAGAAGGACAACACCTATTTACTCGAGTAAATAGGTGTTGTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030248.1-787s21c1
Sequence:CCGGAGGGAAACTCGACGGTGTATGCTCGAGCATACACCGTCGAGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030248.1-1708s21c1
Sequence:CCGGTTGGAGACAGAGCCATGAGGACTCGAGTCCTCATGGCTCTGTCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030248.1-300s21c1
Sequence:CCGGAGAATAGTGGACCTTCTTAAACTCGAGTTTAAGAAGGTCCACTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030248.1-1327s21c1
Sequence:CCGGTGCGGATGCAGCACCTGTTTACTCGAGTAAACAGGTGCTGCATCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030248
CDK5RAP3 MISSION shRNA shRNA Plasmid DNA
CDK5 regulatory subunit associated protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030248.1-1532s1c1
Sequence:CCGGGAAACTGATTGAAGCCGACATCTCGAGATGTCGGCTTCAATCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030248.1-1125s1c1
Sequence:CCGGGAAACTCGGAATCAGTTCATTCTCGAGAATGAACTGATTCCGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030248.1-158s1c1
Sequence:CCGGCAGAAGACACTGTAACCTAAACTCGAGTTTAGGTTACAGTGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030248.1-405s1c1
Sequence:CCGGGAGAAGGACAACACCTATTTACTCGAGTAAATAGGTGTTGTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030248.1-405s21c1
Sequence:CCGGGAGAAGGACAACACCTATTTACTCGAGTAAATAGGTGTTGTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030248.1-787s21c1
Sequence:CCGGAGGGAAACTCGACGGTGTATGCTCGAGCATACACCGTCGAGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030248.1-1708s21c1
Sequence:CCGGTTGGAGACAGAGCCATGAGGACTCGAGTCCTCATGGCTCTGTCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030248.1-300s21c1
Sequence:CCGGAGAATAGTGGACCTTCTTAAACTCGAGTTTAAGAAGGTCCACTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030248.1-1327s21c1
Sequence:CCGGTGCGGATGCAGCACCTGTTTACTCGAGTAAACAGGTGCTGCATCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030248
CDK5RAP3 MISSION shRNA Lentiviral Transduction Particles
CDK5 regulatory subunit associated protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030248.1-1532s1c1
Sequence:CCGGGAAACTGATTGAAGCCGACATCTCGAGATGTCGGCTTCAATCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030248.1-1125s1c1
Sequence:CCGGGAAACTCGGAATCAGTTCATTCTCGAGAATGAACTGATTCCGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030248.1-158s1c1
Sequence:CCGGCAGAAGACACTGTAACCTAAACTCGAGTTTAGGTTACAGTGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030248.1-405s1c1
Sequence:CCGGGAGAAGGACAACACCTATTTACTCGAGTAAATAGGTGTTGTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030248.1-405s21c1
Sequence:CCGGGAGAAGGACAACACCTATTTACTCGAGTAAATAGGTGTTGTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030248.1-787s21c1
Sequence:CCGGAGGGAAACTCGACGGTGTATGCTCGAGCATACACCGTCGAGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030248.1-1708s21c1
Sequence:CCGGTTGGAGACAGAGCCATGAGGACTCGAGTCCTCATGGCTCTGTCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030248.1-300s21c1
Sequence:CCGGAGAATAGTGGACCTTCTTAAACTCGAGTTTAAGAAGGTCCACTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030248.1-1327s21c1
Sequence:CCGGTGCGGATGCAGCACCTGTTTACTCGAGTAAACAGGTGCTGCATCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025197
VALIDATED
CDK5RAP3 MISSION shRNA Bacterial Glycerol Stock
CDK5 regulatory subunit associated protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025197.2-319s1c1
Sequence:CCGGGAGGCCTCCACGAAGAATATTCTCGAGAATATTCTTCGTGGAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025197.2-375s1c1
Sequence:CCGGGCAGGAGATTATAGCTCTGTACTCGAGTACAGAGCTATAATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025197.2-370s1c1
Sequence:CCGGGATTGGCAGGAGATTATAGCTCTCGAGAGCTATAATCTCCTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025197.2-473s1c1
Sequence:CCGGGTTCTGAGATACCAGGCTTATCTCGAGATAAGCCTGGTATCTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025197.2-405s1c1
Sequence:CCGGCAACACCTACTTAGGTAAAGTCTCGAGACTTTACCTAAGTAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025197.2-397s1c1
Sequence:CCGGGAGAAGGACAACACCTACTTACTCGAGTAAGTAGGTGTTGTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025197.2-1173s1c1
Sequence:CCGGCCCTCACTGAAGAAGCAGATTCTCGAGAATCTGCTTCTTCAGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025197.2-353s1c1
Sequence:CCGGCTTCACAGCGGATGAAGGATTCTCGAGAATCCTTCATCCGCTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025197
VALIDATED
CDK5RAP3 MISSION shRNA shRNA Plasmid DNA
CDK5 regulatory subunit associated protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025197.2-319s1c1
Sequence:CCGGGAGGCCTCCACGAAGAATATTCTCGAGAATATTCTTCGTGGAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025197.2-375s1c1
Sequence:CCGGGCAGGAGATTATAGCTCTGTACTCGAGTACAGAGCTATAATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025197.2-370s1c1
Sequence:CCGGGATTGGCAGGAGATTATAGCTCTCGAGAGCTATAATCTCCTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025197.2-473s1c1
Sequence:CCGGGTTCTGAGATACCAGGCTTATCTCGAGATAAGCCTGGTATCTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025197.2-405s1c1
Sequence:CCGGCAACACCTACTTAGGTAAAGTCTCGAGACTTTACCTAAGTAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025197.2-397s1c1
Sequence:CCGGGAGAAGGACAACACCTACTTACTCGAGTAAGTAGGTGTTGTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025197.2-1173s1c1
Sequence:CCGGCCCTCACTGAAGAAGCAGATTCTCGAGAATCTGCTTCTTCAGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025197.2-353s1c1
Sequence:CCGGCTTCACAGCGGATGAAGGATTCTCGAGAATCCTTCATCCGCTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025197
VALIDATED
CDK5RAP3 MISSION shRNA Lentiviral Transduction Particles
CDK5 regulatory subunit associated protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025197.2-319s1c1
Sequence:CCGGGAGGCCTCCACGAAGAATATTCTCGAGAATATTCTTCGTGGAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025197.2-375s1c1
Sequence:CCGGGCAGGAGATTATAGCTCTGTACTCGAGTACAGAGCTATAATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025197.2-370s1c1
Sequence:CCGGGATTGGCAGGAGATTATAGCTCTCGAGAGCTATAATCTCCTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025197.2-473s1c1
Sequence:CCGGGTTCTGAGATACCAGGCTTATCTCGAGATAAGCCTGGTATCTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025197.2-405s1c1
Sequence:CCGGCAACACCTACTTAGGTAAAGTCTCGAGACTTTACCTAAGTAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025197.2-397s1c1
Sequence:CCGGGAGAAGGACAACACCTACTTACTCGAGTAAGTAGGTGTTGTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025197.2-1173s1c1
Sequence:CCGGCCCTCACTGAAGAAGCAGATTCTCGAGAATCTGCTTCTTCAGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025197.2-353s1c1
Sequence:CCGGCTTCACAGCGGATGAAGGATTCTCGAGAATCCTTCATCCGCTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176096
VALIDATED
CDK5RAP3 MISSION shRNA Bacterial Glycerol Stock
CDK5 regulatory subunit associated protein 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-263s21c1
Sequence:CCGGGGTCCTACATTCACTACTTTCCTCGAGGAAAGTAGTGAATGTAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-191s21c1
Sequence:CCGGCGATCCGCGAGAAGATCAATGCTCGAGCATTGATCTTCTCGCGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-463s21c1
Sequence:CCGGCCCTCACTGAAGAAGCAGATTCTCGAGAATCTGCTTCTTCAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-319s21c1
Sequence:CCGGGAGGCCTCCACGAAGAATATTCTCGAGAATATTCTTCGTGGAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-375s21c1
Sequence:CCGGGCAGGAGATTATAGCTCTGTACTCGAGTACAGAGCTATAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176096
VALIDATED
CDK5RAP3 MISSION shRNA shRNA Plasmid DNA
CDK5 regulatory subunit associated protein 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-263s21c1
Sequence:CCGGGGTCCTACATTCACTACTTTCCTCGAGGAAAGTAGTGAATGTAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-191s21c1
Sequence:CCGGCGATCCGCGAGAAGATCAATGCTCGAGCATTGATCTTCTCGCGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-463s21c1
Sequence:CCGGCCCTCACTGAAGAAGCAGATTCTCGAGAATCTGCTTCTTCAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-319s21c1
Sequence:CCGGGAGGCCTCCACGAAGAATATTCTCGAGAATATTCTTCGTGGAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-375s21c1
Sequence:CCGGGCAGGAGATTATAGCTCTGTACTCGAGTACAGAGCTATAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176096
VALIDATED
CDK5RAP3 MISSION shRNA Lentiviral Transduction Particles
CDK5 regulatory subunit associated protein 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-263s21c1
Sequence:CCGGGGTCCTACATTCACTACTTTCCTCGAGGAAAGTAGTGAATGTAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-191s21c1
Sequence:CCGGCGATCCGCGAGAAGATCAATGCTCGAGCATTGATCTTCTCGCGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-463s21c1
Sequence:CCGGCCCTCACTGAAGAAGCAGATTCTCGAGAATCTGCTTCTTCAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-319s21c1
Sequence:CCGGGAGGCCTCCACGAAGAATATTCTCGAGAATATTCTTCGTGGAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_176096.1-375s21c1
Sequence:CCGGGCAGGAGATTATAGCTCTGTACTCGAGTACAGAGCTATAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks