EMAIL THIS PAGE TO A FRIEND

CDK6

cyclin-dependent kinase 6

Synonyms: PLSTIRE
UniProtKB ID: Q00534
Gene ID:
Human(1021) Summary: The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This kinase is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression and G1/S transition. The activity of this kinase first appears in mid-G1 phase, which is controlled by the regulatory subunits including D-type cyclins and members of INK4 family of CDK inhibitors. This kinase, as well as CDK4, has been shown to phosphorylate, and thus regulate the activity of, tumor suppressor protein Rb. Expression of this gene is up-regulated in some types of cancer. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009]
Mouse(12571) cyclin-dependent kinase 6
Rat(114483) cyclin-dependent kinase 6
sheep(100144761) cyclin-dependent kinase 6
Domestic Rabbit(100009040) cyclin-dependent kinase 6
domestic guinea pig(100732773) cyclin-dependent kinase 6
naked mole-rat(101719908) cyclin-dependent kinase 6
Zebrafish(100034507) cyclin-dependent kinase 6
cow(511754) cyclin-dependent kinase 6
Horse(100061625) cyclin-dependent kinase 6
domestic cat(100037415) cyclin-dependent kinase 6
dog(609920) cyclin-dependent kinase 6
chicken(420558) cyclin-dependent kinase 6
337 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300595 Anti-CDK6 (Ab-13) antibody produced in rabbit affinity isolated antibody mouse, human
immunofluorescence, immunohistochemistry pricing
SAB4300596 Anti-CDK6 (Ab-24) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
HPA002637 Anti-CDK6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
AV03005 Anti-CDK6 antibody produced in rabbit IgG fraction of antiserum horse, bovine, canine, rabbit, mouse, pig, human
western blot pricing
SAB4300279 Anti-phospho-CDK6 (pTyr13) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry pricing
SAB4300280 Anti-phospho-CDK6 (pTyr24) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
WH0001021M1 Monoclonal Anti-CDK6 antibody produced in mouse clone 8H4, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001259 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001259 siRNAs that have been validated in the lab human pricing
XM_001068770 Rosetta Predictions rat pricing
XM_342638 Rosetta Predictions rat pricing
NM_009873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001259 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048790 validated 1183
1 SASI_Hs01_00048791 validated 747
1 SASI_Hs01_00048792 validated 680
2 SASI_Hs02_00331446 predicted 1343
3 SASI_Hs01_00048794 predicted 754
4 SASI_Hs01_00048795 predicted 1208
5 SASI_Hs01_00048796 predicted 656
6 SASI_Hs01_00048797 predicted 995
7 SASI_Hs01_00048798 predicted 660
8 SASI_Hs02_00331447 predicted 1011
9 SASI_Hs01_00048793 predicted 899
10 SASI_Hs01_00048799 predicted 1060
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325776 predicted 1283
2 SASI_Rn02_00325777 predicted 1276
3 SASI_Rn02_00325778 predicted 774
4 SASI_Rn02_00325779 predicted 823
5 SASI_Rn02_00325780 predicted 1295
6 SASI_Rn02_00325781 predicted 1287
7 SASI_Rn02_00325782 predicted 772
8 SASI_Rn02_00325783 predicted 1326
9 SASI_Rn02_00325784 predicted 814
10 SASI_Rn02_00325785 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394570 predicted 1447
2 SASI_Rn02_00394571 predicted 1458
3 SASI_Rn02_00394572 predicted 1451
4 SASI_Rn02_00394573 predicted 1595
5 SASI_Rn02_00394574 predicted 1446
6 SASI_Rn02_00394575 predicted 1576
7 SASI_Rn02_00394576 predicted 1575
8 SASI_Rn02_00394577 predicted 1574
9 SASI_Rn02_00394578 predicted 1495
10 SASI_Rn02_00394579 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200220 predicted 872
2 SASI_Mm01_00200221 predicted 468
3 SASI_Mm01_00200222 predicted 367
4 SASI_Mm01_00200223 predicted 851
5 SASI_Mm01_00200224 predicted 402
6 SASI_Mm01_00200225 predicted 859
7 SASI_Mm01_00200227 predicted 418
8 SASI_Mm01_00200228 predicted 889
9 SASI_Mm01_00200229 predicted 523
10 SASI_Mm02_00317338 predicted 413
11 SASI_Mm01_00200226 predicted 843
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009873
VALIDATED
CDK6 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009873.2-887s21c1
Sequence:CCGGCTGAAATGCCTGACGTTTAATCTCGAGATTAAACGTCAGGCATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009873.2-1175s21c1
Sequence:CCGGCCAAGGAAACCACCTAGTTTACTCGAGTAAACTAGGTGGTTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009873.1-895s1c1
Sequence:CCGGCCTGACGTTTAATCCAGCTAACTCGAGTTAGCTGGATTAAACGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009873.1-670s1c1
Sequence:CCGGCGGTTGCATCTTTGCAGAAATCTCGAGATTTCTGCAAAGATGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009873.1-367s1c1
Sequence:CCGGCTTGACCACTTACTTGGATAACTCGAGTTATCCAAGTAAGTGGTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009873.1-830s1c1
Sequence:CCGGGCTCAACCCATCGAGAAGTTTCTCGAGAAACTTCTCGATGGGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009873.1-873s1c1
Sequence:CCGGGCAAAGACCTACTTCTGAAATCTCGAGATTTCAGAAGTAGGTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009873
VALIDATED
CDK6 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009873.2-887s21c1
Sequence:CCGGCTGAAATGCCTGACGTTTAATCTCGAGATTAAACGTCAGGCATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009873.2-1175s21c1
Sequence:CCGGCCAAGGAAACCACCTAGTTTACTCGAGTAAACTAGGTGGTTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009873.1-895s1c1
Sequence:CCGGCCTGACGTTTAATCCAGCTAACTCGAGTTAGCTGGATTAAACGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009873.1-670s1c1
Sequence:CCGGCGGTTGCATCTTTGCAGAAATCTCGAGATTTCTGCAAAGATGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009873.1-367s1c1
Sequence:CCGGCTTGACCACTTACTTGGATAACTCGAGTTATCCAAGTAAGTGGTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009873.1-830s1c1
Sequence:CCGGGCTCAACCCATCGAGAAGTTTCTCGAGAAACTTCTCGATGGGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009873.1-873s1c1
Sequence:CCGGGCAAAGACCTACTTCTGAAATCTCGAGATTTCAGAAGTAGGTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009873
VALIDATED
CDK6 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009873.2-887s21c1
Sequence:CCGGCTGAAATGCCTGACGTTTAATCTCGAGATTAAACGTCAGGCATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009873.2-1175s21c1
Sequence:CCGGCCAAGGAAACCACCTAGTTTACTCGAGTAAACTAGGTGGTTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009873.1-895s1c1
Sequence:CCGGCCTGACGTTTAATCCAGCTAACTCGAGTTAGCTGGATTAAACGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009873.1-670s1c1
Sequence:CCGGCGGTTGCATCTTTGCAGAAATCTCGAGATTTCTGCAAAGATGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009873.1-367s1c1
Sequence:CCGGCTTGACCACTTACTTGGATAACTCGAGTTATCCAAGTAAGTGGTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009873.1-830s1c1
Sequence:CCGGGCTCAACCCATCGAGAAGTTTCTCGAGAAACTTCTCGATGGGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009873.1-873s1c1
Sequence:CCGGGCAAAGACCTACTTCTGAAATCTCGAGATTTCAGAAGTAGGTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001259
VALIDATED
CDK6 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 6
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.x-720s1c2
Sequence:CCGGTCTGGAGTGTTGGCTGCATATCTCGAGATATGCAGCCAACACTCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039745    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_001259.3-1171s1c1
Sequence:CCGGCAACCAATTGAGAAGTTTGTACTCGAGTACAAACTTCTCAATTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-1113s1c1
Sequence:CCGGTTAAGCTGATCCTGCGGAGAACTCGAGTTCTCCGCAGGATCAGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-833s1c1
Sequence:CCGGGAAGAAGACTGGCCTAGAGATCTCGAGATCTCTAGGCCAGTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-374s1c1
Sequence:CCGGCGAACAGACAGAGAAACCAAACTCGAGTTTGGTTTCTCTGTCTGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-468s1c1
Sequence:CCGGCCACTGAAACCATAAAGGATACTCGAGTATCCTTTATGGTTTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-1000s1c1
Sequence:CCGGGTCTCACCCATACTTCCAGGACTCGAGTCCTGGAAGTATGGGTGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-1007s1c1
Sequence:CCGGCCATACTTCCAGGACCTGGAACTCGAGTTCCAGGTCCTGGAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-515s1c1
Sequence:CCGGGACTTTCTTCATTCACACCGACTCGAGTCGGTGTGAATGAAGAAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-1344s1c1
Sequence:CCGGCCAGAACACCTCGGAGCTGAACTCGAGTTCAGCTCCGAGGTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-1189s1c1
Sequence:CCGGGTAACAGATATCGATGAACTACTCGAGTAGTTCATCGATATCTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001259.5-668s1c1
Sequence:CCGGCCAAACTAACTTTAGTGTTTGCTCGAGCAAACACTAAAGTTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-4765s1c1
Sequence:CCGGCATGAGATGTTCCTATCTTAACTCGAGTTAAGATAGGAACATCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-1061s1c1
Sequence:CCGGCAGATGTTGATCAACTAGGAACTCGAGTTCCTAGTTGATCAACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-1180s1c1
Sequence:CCGGGAGAAGTTTGTAACAGATATCCTCGAGGATATCTGTTACAAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001259.5-1021s1c1
Sequence:CCGGGCAGAAATGTTTCGTAGAAAGCTCGAGCTTTCTACGAAACATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001259
VALIDATED
CDK6 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 6
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.x-720s1c2
Sequence:CCGGTCTGGAGTGTTGGCTGCATATCTCGAGATATGCAGCCAACACTCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039745    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_001259.3-1171s1c1
Sequence:CCGGCAACCAATTGAGAAGTTTGTACTCGAGTACAAACTTCTCAATTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-1113s1c1
Sequence:CCGGTTAAGCTGATCCTGCGGAGAACTCGAGTTCTCCGCAGGATCAGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-833s1c1
Sequence:CCGGGAAGAAGACTGGCCTAGAGATCTCGAGATCTCTAGGCCAGTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-374s1c1
Sequence:CCGGCGAACAGACAGAGAAACCAAACTCGAGTTTGGTTTCTCTGTCTGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-468s1c1
Sequence:CCGGCCACTGAAACCATAAAGGATACTCGAGTATCCTTTATGGTTTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-1000s1c1
Sequence:CCGGGTCTCACCCATACTTCCAGGACTCGAGTCCTGGAAGTATGGGTGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-1007s1c1
Sequence:CCGGCCATACTTCCAGGACCTGGAACTCGAGTTCCAGGTCCTGGAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-515s1c1
Sequence:CCGGGACTTTCTTCATTCACACCGACTCGAGTCGGTGTGAATGAAGAAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-1344s1c1
Sequence:CCGGCCAGAACACCTCGGAGCTGAACTCGAGTTCAGCTCCGAGGTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-1189s1c1
Sequence:CCGGGTAACAGATATCGATGAACTACTCGAGTAGTTCATCGATATCTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001259.5-668s1c1
Sequence:CCGGCCAAACTAACTTTAGTGTTTGCTCGAGCAAACACTAAAGTTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-4765s1c1
Sequence:CCGGCATGAGATGTTCCTATCTTAACTCGAGTTAAGATAGGAACATCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-1061s1c1
Sequence:CCGGCAGATGTTGATCAACTAGGAACTCGAGTTCCTAGTTGATCAACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-1180s1c1
Sequence:CCGGGAGAAGTTTGTAACAGATATCCTCGAGGATATCTGTTACAAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001259.5-1021s1c1
Sequence:CCGGGCAGAAATGTTTCGTAGAAAGCTCGAGCTTTCTACGAAACATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001259
VALIDATED
CDK6 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 6
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.x-720s1c2
Sequence:CCGGTCTGGAGTGTTGGCTGCATATCTCGAGATATGCAGCCAACACTCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039745    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_001259.3-1171s1c1
Sequence:CCGGCAACCAATTGAGAAGTTTGTACTCGAGTACAAACTTCTCAATTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-1113s1c1
Sequence:CCGGTTAAGCTGATCCTGCGGAGAACTCGAGTTCTCCGCAGGATCAGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-833s1c1
Sequence:CCGGGAAGAAGACTGGCCTAGAGATCTCGAGATCTCTAGGCCAGTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-374s1c1
Sequence:CCGGCGAACAGACAGAGAAACCAAACTCGAGTTTGGTTTCTCTGTCTGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-468s1c1
Sequence:CCGGCCACTGAAACCATAAAGGATACTCGAGTATCCTTTATGGTTTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-1000s1c1
Sequence:CCGGGTCTCACCCATACTTCCAGGACTCGAGTCCTGGAAGTATGGGTGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-1007s1c1
Sequence:CCGGCCATACTTCCAGGACCTGGAACTCGAGTTCCAGGTCCTGGAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001259.x-515s1c1
Sequence:CCGGGACTTTCTTCATTCACACCGACTCGAGTCGGTGTGAATGAAGAAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-1344s1c1
Sequence:CCGGCCAGAACACCTCGGAGCTGAACTCGAGTTCAGCTCCGAGGTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-1189s1c1
Sequence:CCGGGTAACAGATATCGATGAACTACTCGAGTAGTTCATCGATATCTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001259.5-668s1c1
Sequence:CCGGCCAAACTAACTTTAGTGTTTGCTCGAGCAAACACTAAAGTTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-4765s1c1
Sequence:CCGGCATGAGATGTTCCTATCTTAACTCGAGTTAAGATAGGAACATCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-1061s1c1
Sequence:CCGGCAGATGTTGATCAACTAGGAACTCGAGTTCCTAGTTGATCAACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001259.5-1180s1c1
Sequence:CCGGGAGAAGTTTGTAACAGATATCCTCGAGGATATCTGTTACAAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001259.5-1021s1c1
Sequence:CCGGGCAGAAATGTTTCGTAGAAAGCTCGAGCTTTCTACGAAACATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks