EMAIL THIS PAGE TO A FRIEND

CDK7

cyclin-dependent kinase 7

123 Gene Product Result for
Synonyms: CAK1 CDKN7 HCAK MO15 STK1 p39MO15
UniProtKB ID: P50613, Q9BS60, Q9UE19
Gene ID:
Human(1022) Summary: The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This protein forms a trimeric complex with cyclin H and MAT1, which functions as a Cdk-activating kinase (CAK). It is an essential component of the transcription factor TFIIH, that is involved in transcription initiation and DNA repair. This protein is thought to serve as a direct link between the regulation of transcription and the cell cycle. [provided by RefSeq, Jul 2008]
Mouse(12572) cyclin-dependent kinase 7
Rat(171150) cyclin-dependent kinase 7
Zebrafish(405897) cyclin-dependent kinase 7
cow(515462) cyclin-dependent kinase 7
Horse(100049964) cyclin-dependent kinase 7
domestic cat(101086781) cyclin-dependent kinase 7
dog(608441) cyclin-dependent kinase 7
chicken(771294) cyclin-dependent kinase 7
fruit fly(31441) Cyclin-dependent kinase 7
naked mole-rat(101702664) cyclin-dependent kinase 7
domestic guinea pig(100725955) cyclin-dependent kinase 7
sheep(101119934) cyclin-dependent kinase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2701734 Anti-cdk7 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA007932 Anti-CDK7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV03009 Anti-CDK7 antibody produced in rabbit IgG fraction of antiserum guinea pig, pig, human, canine, horse, rat, bovine, mouse
immunohistochemistry, western blot pricing
SAB2104125 Anti-CDK7 antibody produced in rabbit affinity isolated antibody pig, rat, bovine, horse, canine, guinea pig, human
western blot pricing
SAB4500060 Anti-CDK7 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4500061 Anti-CDK7, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1302608 ANTI-MOUSE CDK7 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4504143 Anti-phospho-CDK7 (pThr170) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
WH0001022M1 Monoclonal Anti-CDK7 antibody produced in mouse clone 1G5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
C7089 Monoclonal Anti-Cdk7/CAK antibody produced in mouse clone MO-1.1, ascites fluid human
immunocytochemistry, immunohistochemistry, immunoprecipitation, microarray, western blot pricing
PLA0103 Rabbit anti-CDK7 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, mouse, gorilla, rat, chimpanzee
immunoprecipitation, proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
O0886 Olomoucine ≥98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001799 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001799 siRNAs that have been validated in the lab human pricing
XM_001071127 Rosetta Predictions rat pricing
XM_215467 Rosetta Predictions rat pricing
NM_009874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001799 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214780 validated 347
1 SASI_Hs01_00214782 validated 289
1 SASI_Hs01_00214781 validated 985
2 SASI_Hs02_00332571 predicted 1117
3 SASI_Hs02_00332572 predicted 778
4 SASI_Hs02_00332573 predicted 966
5 SASI_Hs01_00214785 predicted 981
6 SASI_Hs01_00214786 predicted 938
7 SASI_Hs02_00332574 predicted 927
8 SASI_Hs01_00214787 predicted 1057
9 SASI_Hs01_00214788 predicted 1127
10 SASI_Hs02_00332575 predicted 818
11 SASI_Hs01_00214783 predicted 447
12 SASI_Hs01_00214784 predicted 822
13 SASI_Hs01_00214789 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333955 predicted 595
2 SASI_Rn02_00333956 predicted 429
3 SASI_Rn02_00333957 predicted 200
4 SASI_Rn02_00333958 predicted 251
5 SASI_Rn02_00333959 predicted 658
6 SASI_Rn02_00333960 predicted 807
7 SASI_Rn02_00333961 predicted 418
8 SASI_Rn02_00333962 predicted 730
9 SASI_Rn02_00333963 predicted 537
10 SASI_Rn02_00333964 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376015 predicted 752
2 SASI_Rn02_00376016 predicted 345
3 SASI_Rn02_00376017 predicted 762
4 SASI_Rn02_00376018 predicted 226
5 SASI_Rn02_00376019 predicted 297
6 SASI_Rn02_00376020 predicted 509
7 SASI_Rn02_00376021 predicted 908
8 SASI_Rn02_00376022 predicted 354
9 SASI_Rn02_00376023 predicted 338
10 SASI_Rn02_00376024 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023740 predicted 665
2 SASI_Mm02_00317339 predicted 225
3 SASI_Mm01_00023741 predicted 811
4 SASI_Mm01_00023742 predicted 835
5 SASI_Mm02_00317340 predicted 352
6 SASI_Mm01_00023743 predicted 960
7 SASI_Mm02_00317341 predicted 338
8 SASI_Mm02_00317342 predicted 340
9 SASI_Mm02_00317343 predicted 202
10 SASI_Mm02_00317344 predicted 292
11 SASI_Mm01_00023739 predicted 893
12 SASI_Mm01_00023744 predicted 502
13 SASI_Mm01_00023745 predicted 290
14 SASI_Mm01_00023746 predicted 1027
15 SASI_Mm01_00023747 predicted 378
16 SASI_Mm01_00023748 predicted 382
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001799
VALIDATED
CDK7 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 7
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001799.2-434s1c1
Sequence:CCGGGCCTACATGTTGATGACTCTTCTCGAGAAGAGTCATCAACATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001799.2-1206s1c1
Sequence:CCGGGTAAATGCTGTAGAAGTGAGTCTCGAGACTCACTTCTACAGCATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001799.2-371s1c1
Sequence:CCGGGAAACTGATCTAGAGGTTATACTCGAGTATAACCTCTAGATCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001799.x-831s1c1
Sequence:CCGGCATTTAAGAGTTTCCCTGGAACTCGAGTTCCAGGGAAACTCTTAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001799.x-1212s1c1
Sequence:CCGGGCTGTAGAAGTGAGTTTGTAACTCGAGTTACAAACTCACTTCTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001799.x-233s1c1
Sequence:CCGGTCAGAAGCTAAAGATGGTATACTCGAGTATACCATCTTTAGCTTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001799.x-878s1c1
Sequence:CCGGGCAGGAGACGACTTACTAGATCTCGAGATCTAGTAAGTCGTCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001799.3-242s21c1
Sequence:GTACCGGGGACAGTTTGCCACCGTTTACCTCGAGGTAAACGGTGGCAAACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001799.3-329s21c1
Sequence:CCGGGAAGCTAAAGATGGTATAAATCTCGAGATTTATACCATCTTTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001799.3-283s1c1
Sequence:CCGGCAACCAAATTGTCGCCATTAACTCGAGTTAATGGCGACAATTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001799.3-1015s21c1
Sequence:GTACCGGTAATCCATGTGCTCGAATTACCTCGAGGTAATTCGAGCACATGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001799.3-1223s21c1
Sequence:GTACCGGAGAGAACACTGGACAACATTTCTCGAGAAATGTTGTCCAGTGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001799.3-1015s1c2
Sequence:CCGGTAATCCATGTGCTCGAATTACCTCGAGGTAATTCGAGCACATGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001799.3-464s21c1
Sequence:CCGGGAAACTGATCTAGAGGTTATACTCGAGTATAACCTCTAGATCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001799.3-283s21c1
Sequence:CCGGCAACCAAATTGTCGCCATTAACTCGAGTTAATGGCGACAATTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001799
VALIDATED
CDK7 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 7
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001799.2-434s1c1
Sequence:CCGGGCCTACATGTTGATGACTCTTCTCGAGAAGAGTCATCAACATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001799.2-1206s1c1
Sequence:CCGGGTAAATGCTGTAGAAGTGAGTCTCGAGACTCACTTCTACAGCATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001799.2-371s1c1
Sequence:CCGGGAAACTGATCTAGAGGTTATACTCGAGTATAACCTCTAGATCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001799.x-831s1c1
Sequence:CCGGCATTTAAGAGTTTCCCTGGAACTCGAGTTCCAGGGAAACTCTTAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001799.x-1212s1c1
Sequence:CCGGGCTGTAGAAGTGAGTTTGTAACTCGAGTTACAAACTCACTTCTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001799.x-233s1c1
Sequence:CCGGTCAGAAGCTAAAGATGGTATACTCGAGTATACCATCTTTAGCTTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001799.x-878s1c1
Sequence:CCGGGCAGGAGACGACTTACTAGATCTCGAGATCTAGTAAGTCGTCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001799.3-242s21c1
Sequence:GTACCGGGGACAGTTTGCCACCGTTTACCTCGAGGTAAACGGTGGCAAACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001799.3-329s21c1
Sequence:CCGGGAAGCTAAAGATGGTATAAATCTCGAGATTTATACCATCTTTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001799.3-283s1c1
Sequence:CCGGCAACCAAATTGTCGCCATTAACTCGAGTTAATGGCGACAATTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001799.3-1015s21c1
Sequence:GTACCGGTAATCCATGTGCTCGAATTACCTCGAGGTAATTCGAGCACATGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001799.3-1223s21c1
Sequence:GTACCGGAGAGAACACTGGACAACATTTCTCGAGAAATGTTGTCCAGTGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001799.3-1015s1c2
Sequence:CCGGTAATCCATGTGCTCGAATTACCTCGAGGTAATTCGAGCACATGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001799.3-464s21c1
Sequence:CCGGGAAACTGATCTAGAGGTTATACTCGAGTATAACCTCTAGATCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001799.3-283s21c1
Sequence:CCGGCAACCAAATTGTCGCCATTAACTCGAGTTAATGGCGACAATTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001799
VALIDATED
CDK7 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 7
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001799.2-434s1c1
Sequence:CCGGGCCTACATGTTGATGACTCTTCTCGAGAAGAGTCATCAACATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001799.2-1206s1c1
Sequence:CCGGGTAAATGCTGTAGAAGTGAGTCTCGAGACTCACTTCTACAGCATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001799.2-371s1c1
Sequence:CCGGGAAACTGATCTAGAGGTTATACTCGAGTATAACCTCTAGATCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001799.x-831s1c1
Sequence:CCGGCATTTAAGAGTTTCCCTGGAACTCGAGTTCCAGGGAAACTCTTAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001799.x-1212s1c1
Sequence:CCGGGCTGTAGAAGTGAGTTTGTAACTCGAGTTACAAACTCACTTCTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001799.x-233s1c1
Sequence:CCGGTCAGAAGCTAAAGATGGTATACTCGAGTATACCATCTTTAGCTTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001799.x-878s1c1
Sequence:CCGGGCAGGAGACGACTTACTAGATCTCGAGATCTAGTAAGTCGTCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001799.3-242s21c1
Sequence:GTACCGGGGACAGTTTGCCACCGTTTACCTCGAGGTAAACGGTGGCAAACTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001799.3-329s21c1
Sequence:CCGGGAAGCTAAAGATGGTATAAATCTCGAGATTTATACCATCTTTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001799.3-283s1c1
Sequence:CCGGCAACCAAATTGTCGCCATTAACTCGAGTTAATGGCGACAATTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001799.3-1015s21c1
Sequence:GTACCGGTAATCCATGTGCTCGAATTACCTCGAGGTAATTCGAGCACATGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001799.3-1223s21c1
Sequence:GTACCGGAGAGAACACTGGACAACATTTCTCGAGAAATGTTGTCCAGTGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001799.3-1015s1c2
Sequence:CCGGTAATCCATGTGCTCGAATTACCTCGAGGTAATTCGAGCACATGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001799.3-464s21c1
Sequence:CCGGGAAACTGATCTAGAGGTTATACTCGAGTATAACCTCTAGATCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001799.3-283s21c1
Sequence:CCGGCAACCAAATTGTCGCCATTAACTCGAGTTAATGGCGACAATTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009874
VALIDATED
CDK7 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009874.1-503s1c1
Sequence:CCGGCCAAACAACTTGTTGTTAGATCTCGAGATCTAACAACAAGTTGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009874.1-812s1c1
Sequence:CCGGCTTCCCGATTATGTGACATTTCTCGAGAAATGTCACATAATCGGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009874.1-186s1c1
Sequence:CCGGCCAACCAAATCGTCGCCATTACTCGAGTAATGGCGACGATTTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009874.1-620s1c1
Sequence:CCGGCGGGCTCCTGAGTTATTGTTTCTCGAGAAACAATAACTCAGGAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009874.1-409s1c1
Sequence:CCGGGCTGACACCATCCCACATTAACTCGAGTTAATGTGGGATGGTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009874.3-204s21c1
Sequence:CCGGCCAACCAAATCGTCGCCATTACTCGAGTAATGGCGACGATTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009874.3-821s21c1
Sequence:CCGGATGTGTAGTCTTCCCGATTATCTCGAGATAATCGGGAAGACTACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009874.3-1036s21c1
Sequence:CCGGCTGTCCGGTGGAGGCATTAAACTCGAGTTTAATGCCTCCACCGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009874.3-1337s21c1
Sequence:CCGGAGGATAACTGCAGTCTCTAAACTCGAGTTTAGAGACTGCAGTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009874.3-638s21c1
Sequence:CCGGCGGGCTCCTGAGTTATTGTTTCTCGAGAAACAATAACTCAGGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009874
VALIDATED
CDK7 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009874.1-503s1c1
Sequence:CCGGCCAAACAACTTGTTGTTAGATCTCGAGATCTAACAACAAGTTGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009874.1-812s1c1
Sequence:CCGGCTTCCCGATTATGTGACATTTCTCGAGAAATGTCACATAATCGGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009874.1-186s1c1
Sequence:CCGGCCAACCAAATCGTCGCCATTACTCGAGTAATGGCGACGATTTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009874.1-620s1c1
Sequence:CCGGCGGGCTCCTGAGTTATTGTTTCTCGAGAAACAATAACTCAGGAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009874.1-409s1c1
Sequence:CCGGGCTGACACCATCCCACATTAACTCGAGTTAATGTGGGATGGTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009874.3-204s21c1
Sequence:CCGGCCAACCAAATCGTCGCCATTACTCGAGTAATGGCGACGATTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009874.3-821s21c1
Sequence:CCGGATGTGTAGTCTTCCCGATTATCTCGAGATAATCGGGAAGACTACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009874.3-1036s21c1
Sequence:CCGGCTGTCCGGTGGAGGCATTAAACTCGAGTTTAATGCCTCCACCGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009874.3-1337s21c1
Sequence:CCGGAGGATAACTGCAGTCTCTAAACTCGAGTTTAGAGACTGCAGTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009874.3-638s21c1
Sequence:CCGGCGGGCTCCTGAGTTATTGTTTCTCGAGAAACAATAACTCAGGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009874
VALIDATED
CDK7 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009874.1-503s1c1
Sequence:CCGGCCAAACAACTTGTTGTTAGATCTCGAGATCTAACAACAAGTTGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009874.1-812s1c1
Sequence:CCGGCTTCCCGATTATGTGACATTTCTCGAGAAATGTCACATAATCGGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009874.1-186s1c1
Sequence:CCGGCCAACCAAATCGTCGCCATTACTCGAGTAATGGCGACGATTTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009874.1-620s1c1
Sequence:CCGGCGGGCTCCTGAGTTATTGTTTCTCGAGAAACAATAACTCAGGAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009874.1-409s1c1
Sequence:CCGGGCTGACACCATCCCACATTAACTCGAGTTAATGTGGGATGGTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009874.3-204s21c1
Sequence:CCGGCCAACCAAATCGTCGCCATTACTCGAGTAATGGCGACGATTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009874.3-821s21c1
Sequence:CCGGATGTGTAGTCTTCCCGATTATCTCGAGATAATCGGGAAGACTACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009874.3-1036s21c1
Sequence:CCGGCTGTCCGGTGGAGGCATTAAACTCGAGTTTAATGCCTCCACCGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009874.3-1337s21c1
Sequence:CCGGAGGATAACTGCAGTCTCTAAACTCGAGTTTAGAGACTGCAGTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009874.3-638s21c1
Sequence:CCGGCGGGCTCCTGAGTTATTGTTTCTCGAGAAACAATAACTCAGGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks