EMAIL THIS PAGE TO A FRIEND

CDK8

cyclin-dependent kinase 8

137 Gene Product Result for
Synonyms: K35
UniProtKB ID: P49336, Q5VUF3, Q6ISB5
Gene ID:
Human(1024) Summary: The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This kinase and its regulatory subunit cyclin C are components of the RNA polymerase II holoenzyme complex, which phosphorylates the carboxy-terminal domain (CTD) of the largest subunit of RNA polymerase II. This kinase has also been shown to regulate transcription by targeting the CDK7/cyclin H subunits of the general transcription initiation factor IIH (TFIIH), thus providing a link between the 'Mediator-like' protein complexes and the basal transcription machinery. [provided by RefSeq, Jul 2008]
Mouse(264064) cyclin-dependent kinase 8
Zebrafish(373868) cyclin-dependent kinase 8
cow(507149) cyclin-dependent kinase 8
Horse(100050819) cyclin-dependent kinase 8
domestic cat(101086278) cyclin-dependent kinase 8
dog(486035) cyclin-dependent kinase 8
chicken(428080) cyclin-dependent kinase 8
fruit fly(39157) Cyclin-dependent kinase 8
sheep(101115551) cyclin-dependent kinase 8
Domestic Rabbit(100353845) cyclin-dependent kinase 8
domestic guinea pig(100718250) cyclin-dependent kinase 8
naked mole-rat(101719987) cyclin-dependent kinase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301747 Anti-CDK8 affinity isolated antibody human, mouse
immunohistochemistry pricing
C7369 Anti-CDK8 (421-435) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1411939 ANTI-CDK8 antibody produced in mouse clone 5H4, purified immunoglobulin, buffered aqueous solution , human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411940 ANTI-CDK8 antibody produced in mouse clone 2E6, purified immunoglobulin, buffered aqueous solution human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV03050 Anti-CDK8 antibody produced in rabbit IgG fraction of antiserum zebrafish, horse, bovine, human, mouse, rabbit, canine, pig
western blot pricing
HPA044721 Anti-CDK8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4500062 Anti-CDK8, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB1304045 ANTI-MOUSE CDK8 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
WH0001024M1 Monoclonal Anti-CDK8 antibody produced in mouse clone 6H5, purified immunoglobulin, buffered aqueous solution mouse
ELISA, western blot pricing
SAB1403658 Monoclonal Anti-CDK8, (C-terminal) antibody produced in mouse clone 6E5, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
O0886 Olomoucine ≥98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001260 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001260 siRNAs that have been validated in the lab human pricing
NM_153599 Rosetta Predictions mouse pricing
NM_181570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001260 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000018 validated 1626
1 SASI_WI_00000017 validated 466
1 SASI_WI_00000016 validated 844
2 SASI_Hs01_00151642 predicted 875
3 SASI_Hs01_00151643 predicted 304
4 SASI_Hs02_00331448 predicted 981
5 SASI_Hs01_00151644 predicted 1427
6 SASI_Hs01_00151645 predicted 577
7 SASI_Hs01_00151647 predicted 1509
8 SASI_Hs01_00151648 predicted 467
9 SASI_Hs01_00151649 predicted 227
10 SASI_Hs01_00151650 predicted 1485
11 SASI_Hs01_00151651 predicted 867
12 SASI_Hs01_00151646 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343436 predicted 657
2 SASI_Mm01_00128669 predicted 1272
3 SASI_Mm02_00343437 predicted 459
4 SASI_Mm02_00343438 predicted 879
5 SASI_Mm02_00343439 predicted 211
6 SASI_Mm02_00343440 predicted 886
7 SASI_Mm02_00343441 predicted 565
8 SASI_Mm02_00343442 predicted 961
9 SASI_Mm01_00128672 predicted 1069
10 SASI_Mm02_00343443 predicted 839
11 SASI_Mm01_00128668 predicted 1804
12 SASI_Mm01_00128670 predicted 1582
13 SASI_Mm01_00128671 predicted 1576
14 SASI_Mm01_00128673 predicted 1898
15 SASI_Mm01_00128674 predicted 1259
16 SASI_Mm01_00128675 predicted 1636
17 SASI_Mm01_00128676 predicted 1272
18 SASI_Mm01_00128677 predicted 1809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093001 predicted 1249
2 SASI_Mm01_00093002 predicted 731
3 SASI_Mm01_00093003 predicted 1024
4 SASI_Mm01_00093004 predicted 1027
5 SASI_Mm01_00093005 predicted 514
6 SASI_Mm01_00093006 predicted 1347
7 SASI_Mm01_00093007 predicted 706
8 SASI_Mm01_00093008 predicted 1079
9 SASI_Mm01_00093009 predicted 724
10 SASI_Mm01_00093010 predicted 1259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001260
VALIDATED
CDK8 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 8
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001260.1-405s21c1
Sequence:GTACCGGATGGTGAAGTCACTATTATATCTCGAGATATAATAGTGACTTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001260.1-1537s21c1
Sequence:CCGGATGTCCAGTAGCCAAGTTCCACTCGAGTGGAACTTGGCTACTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001260.1-1154s21c1
Sequence:CCGGGCAGGGCAATAACCACACTAACTCGAGTTAGTGTGGTTATTGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001260.1-708s21c1
Sequence:CCGGCTAACGTCAGAACCAATATTTCTCGAGAAATATTGGTTCTGACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001260.1-971s21c1
Sequence:CCGGGCTTACCATGGACCCAATAAACTCGAGTTTATTGGGTCCATGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001260.x-1537s1c1
Sequence:CCGGATGTCCAGTAGCCAAGTTCCACTCGAGTGGAACTTGGCTACTGGACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.x-1154s1c1
Sequence:CCGGGCAGGGCAATAACCACACTAACTCGAGTTAGTGTGGTTATTGCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.x-335s1c1
Sequence:CCGGCCTCTGGCATATAATCAAGTTCTCGAGAACTTGATTATATGCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.x-649s1c1
Sequence:CCGGCAAGGCATTATACCAAAGCTACTCGAGTAGCTTTGGTATAATGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.x-1042s1c1
Sequence:CCGGCACTTCCTACATCAGACGTTTCTCGAGAAACGTCTGATGTAGGAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001260.1-1489s1c1
Sequence:CCGGGAACCTGGTATGGGCCATGAGCTCGAGCTCATGGCCCATACCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.1-666s1c1
Sequence:CCGGGCTATTGATATTTGGGCTATACTCGAGTATAGCCCAAATATCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.1-237s1c1
Sequence:CCGGCGAGAGCTTAAGCATCCAAACCTCGAGGTTTGGATGCTTAAGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194708    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001260.1-1504s1c1
Sequence:CCGGCATGAGAATGTACTGTACAACCTCGAGGTTGTACAGTACATTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.1-1256s1c1
Sequence:CCGGCACTACCTCAGGTGGACTTATCTCGAGATAAGTCCACCTGAGGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.1-403s1c1
Sequence:CCGGGAATGGTGAAGTCACTATTATCTCGAGATAATAGTGACTTCACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001260
VALIDATED
CDK8 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 8
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001260.1-405s21c1
Sequence:GTACCGGATGGTGAAGTCACTATTATATCTCGAGATATAATAGTGACTTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001260.1-1537s21c1
Sequence:CCGGATGTCCAGTAGCCAAGTTCCACTCGAGTGGAACTTGGCTACTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001260.1-1154s21c1
Sequence:CCGGGCAGGGCAATAACCACACTAACTCGAGTTAGTGTGGTTATTGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001260.1-708s21c1
Sequence:CCGGCTAACGTCAGAACCAATATTTCTCGAGAAATATTGGTTCTGACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001260.1-971s21c1
Sequence:CCGGGCTTACCATGGACCCAATAAACTCGAGTTTATTGGGTCCATGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001260.x-1537s1c1
Sequence:CCGGATGTCCAGTAGCCAAGTTCCACTCGAGTGGAACTTGGCTACTGGACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.x-1154s1c1
Sequence:CCGGGCAGGGCAATAACCACACTAACTCGAGTTAGTGTGGTTATTGCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.x-335s1c1
Sequence:CCGGCCTCTGGCATATAATCAAGTTCTCGAGAACTTGATTATATGCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.x-649s1c1
Sequence:CCGGCAAGGCATTATACCAAAGCTACTCGAGTAGCTTTGGTATAATGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.x-1042s1c1
Sequence:CCGGCACTTCCTACATCAGACGTTTCTCGAGAAACGTCTGATGTAGGAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001260.1-1489s1c1
Sequence:CCGGGAACCTGGTATGGGCCATGAGCTCGAGCTCATGGCCCATACCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.1-666s1c1
Sequence:CCGGGCTATTGATATTTGGGCTATACTCGAGTATAGCCCAAATATCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.1-237s1c1
Sequence:CCGGCGAGAGCTTAAGCATCCAAACCTCGAGGTTTGGATGCTTAAGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194708    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001260.1-1504s1c1
Sequence:CCGGCATGAGAATGTACTGTACAACCTCGAGGTTGTACAGTACATTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.1-1256s1c1
Sequence:CCGGCACTACCTCAGGTGGACTTATCTCGAGATAAGTCCACCTGAGGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.1-403s1c1
Sequence:CCGGGAATGGTGAAGTCACTATTATCTCGAGATAATAGTGACTTCACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001260
VALIDATED
CDK8 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 8
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001260.1-405s21c1
Sequence:GTACCGGATGGTGAAGTCACTATTATATCTCGAGATATAATAGTGACTTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001260.1-1537s21c1
Sequence:CCGGATGTCCAGTAGCCAAGTTCCACTCGAGTGGAACTTGGCTACTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001260.1-1154s21c1
Sequence:CCGGGCAGGGCAATAACCACACTAACTCGAGTTAGTGTGGTTATTGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001260.1-708s21c1
Sequence:CCGGCTAACGTCAGAACCAATATTTCTCGAGAAATATTGGTTCTGACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001260.1-971s21c1
Sequence:CCGGGCTTACCATGGACCCAATAAACTCGAGTTTATTGGGTCCATGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001260.x-1537s1c1
Sequence:CCGGATGTCCAGTAGCCAAGTTCCACTCGAGTGGAACTTGGCTACTGGACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.x-1154s1c1
Sequence:CCGGGCAGGGCAATAACCACACTAACTCGAGTTAGTGTGGTTATTGCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.x-335s1c1
Sequence:CCGGCCTCTGGCATATAATCAAGTTCTCGAGAACTTGATTATATGCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.x-649s1c1
Sequence:CCGGCAAGGCATTATACCAAAGCTACTCGAGTAGCTTTGGTATAATGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.x-1042s1c1
Sequence:CCGGCACTTCCTACATCAGACGTTTCTCGAGAAACGTCTGATGTAGGAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001260.1-1489s1c1
Sequence:CCGGGAACCTGGTATGGGCCATGAGCTCGAGCTCATGGCCCATACCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.1-666s1c1
Sequence:CCGGGCTATTGATATTTGGGCTATACTCGAGTATAGCCCAAATATCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.1-237s1c1
Sequence:CCGGCGAGAGCTTAAGCATCCAAACCTCGAGGTTTGGATGCTTAAGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194708    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001260.1-1504s1c1
Sequence:CCGGCATGAGAATGTACTGTACAACCTCGAGGTTGTACAGTACATTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.1-1256s1c1
Sequence:CCGGCACTACCTCAGGTGGACTTATCTCGAGATAAGTCCACCTGAGGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001260.1-403s1c1
Sequence:CCGGGAATGGTGAAGTCACTATTATCTCGAGATAATAGTGACTTCACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153599
VALIDATED
CDK8 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 8
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-668s21c1
Sequence:CCGGTTTGGGCTATAGGGTGTATATCTCGAGATATACACCCTATAGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153599.3-1893s21c1
Sequence:CCGGGTCTTATCAGTGGGTTGATTCCTCGAGGAATCAACCCACTGATAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-321s21c1
Sequence:CCGGGCATGACCTCTGGCATATAATCTCGAGATTATATGCCAGAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-537s21c1
Sequence:CCGGCATGGGCTTTGCCCGATTATTCTCGAGAATAATCGGGCAAAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-700s21c1
Sequence:CCGGCTAACGTCAGAACCAATATTTCTCGAGAAATATTGGTTCTGACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-651s21c1
Sequence:CCGGTACCAAAGCAATTGATATTTGCTCGAGCAAATATCAATTGCTTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-659s21c1
Sequence:CCGGCAATTGATATTTGGGCTATAGCTCGAGCTATAGCCCAAATATCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-684s21c1
Sequence:CCGGTATATTTGCAGAACTACTAACCTCGAGGTTAGTAGTTCTGCAAATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153599.2-544s1c1
Sequence:CCGGCCCGATTATTTAATTCACCTTCTCGAGAAGGTGAATTAAATAATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153599.2-1104s1c1
Sequence:CCGGCCTGATGAGAAAGGAGACAAACTCGAGTTTGTCTCCTTTCTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153599.2-801s1c1
Sequence:CCGGGCAGATAAAGATTGGGAAGATCTCGAGATCTTCCCAATCTTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153599.2-638s1c1
Sequence:CCGGGCGACATTATACCAAAGCAATCTCGAGATTGCTTTGGTATAATGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153599.2-654s1c1
Sequence:CCGGGCAATTGATATTTGGGCTATACTCGAGTATAGCCCAAATATCAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153599
VALIDATED
CDK8 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 8
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-668s21c1
Sequence:CCGGTTTGGGCTATAGGGTGTATATCTCGAGATATACACCCTATAGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153599.3-1893s21c1
Sequence:CCGGGTCTTATCAGTGGGTTGATTCCTCGAGGAATCAACCCACTGATAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-321s21c1
Sequence:CCGGGCATGACCTCTGGCATATAATCTCGAGATTATATGCCAGAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-537s21c1
Sequence:CCGGCATGGGCTTTGCCCGATTATTCTCGAGAATAATCGGGCAAAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-700s21c1
Sequence:CCGGCTAACGTCAGAACCAATATTTCTCGAGAAATATTGGTTCTGACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-651s21c1
Sequence:CCGGTACCAAAGCAATTGATATTTGCTCGAGCAAATATCAATTGCTTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-659s21c1
Sequence:CCGGCAATTGATATTTGGGCTATAGCTCGAGCTATAGCCCAAATATCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-684s21c1
Sequence:CCGGTATATTTGCAGAACTACTAACCTCGAGGTTAGTAGTTCTGCAAATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153599.2-544s1c1
Sequence:CCGGCCCGATTATTTAATTCACCTTCTCGAGAAGGTGAATTAAATAATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153599.2-1104s1c1
Sequence:CCGGCCTGATGAGAAAGGAGACAAACTCGAGTTTGTCTCCTTTCTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153599.2-801s1c1
Sequence:CCGGGCAGATAAAGATTGGGAAGATCTCGAGATCTTCCCAATCTTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153599.2-638s1c1
Sequence:CCGGGCGACATTATACCAAAGCAATCTCGAGATTGCTTTGGTATAATGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153599.2-654s1c1
Sequence:CCGGGCAATTGATATTTGGGCTATACTCGAGTATAGCCCAAATATCAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153599
VALIDATED
CDK8 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 8
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-668s21c1
Sequence:CCGGTTTGGGCTATAGGGTGTATATCTCGAGATATACACCCTATAGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153599.3-1893s21c1
Sequence:CCGGGTCTTATCAGTGGGTTGATTCCTCGAGGAATCAACCCACTGATAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-321s21c1
Sequence:CCGGGCATGACCTCTGGCATATAATCTCGAGATTATATGCCAGAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-537s21c1
Sequence:CCGGCATGGGCTTTGCCCGATTATTCTCGAGAATAATCGGGCAAAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-700s21c1
Sequence:CCGGCTAACGTCAGAACCAATATTTCTCGAGAAATATTGGTTCTGACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-651s21c1
Sequence:CCGGTACCAAAGCAATTGATATTTGCTCGAGCAAATATCAATTGCTTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-659s21c1
Sequence:CCGGCAATTGATATTTGGGCTATAGCTCGAGCTATAGCCCAAATATCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153599.3-684s21c1
Sequence:CCGGTATATTTGCAGAACTACTAACCTCGAGGTTAGTAGTTCTGCAAATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153599.2-544s1c1
Sequence:CCGGCCCGATTATTTAATTCACCTTCTCGAGAAGGTGAATTAAATAATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153599.2-1104s1c1
Sequence:CCGGCCTGATGAGAAAGGAGACAAACTCGAGTTTGTCTCCTTTCTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153599.2-801s1c1
Sequence:CCGGGCAGATAAAGATTGGGAAGATCTCGAGATCTTCCCAATCTTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153599.2-638s1c1
Sequence:CCGGGCGACATTATACCAAAGCAATCTCGAGATTGCTTTGGTATAATGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153599.2-654s1c1
Sequence:CCGGGCAATTGATATTTGGGCTATACTCGAGTATAGCCCAAATATCAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks