EMAIL THIS PAGE TO A FRIEND

CDK9

cyclin-dependent kinase 9

92 Gene Product Result for
Synonyms: C-2k CDC2L4 CTK1 PITALRE TAK
UniProtKB ID: P50750, Q5JU24, Q5JU25, Q5U006, Q96TF1
Gene ID:
Human(1025) Summary: The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and known as important cell cycle regulators. This kinase was found to be a component of the multiprotein complex TAK/P-TEFb, which is an elongation factor for RNA polymerase II-directed transcription and functions by phosphorylating the C-terminal domain of the largest subunit of RNA polymerase II. This protein forms a complex with and is regulated by its regulatory subunit cyclin T or cyclin K. HIV-1 Tat protein was found to interact with this protein and cyclin T, which suggested a possible involvement of this protein in AIDS. [provided by RefSeq, Jul 2008]
Mouse(107951) cyclin-dependent kinase 9 (CDC2-related kinase)
Rat(362110) cyclin-dependent kinase 9
Zebrafish(321602) cyclin-dependent kinase 9 (CDC2-related kinase)
chicken(417226) cyclin-dependent kinase 9
fruit fly(37586) Cyclin-dependent kinase 9
dog(491325) cyclin-dependent kinase 9
cow(520580) cyclin-dependent kinase 9
domestic cat(101097767) cyclin-dependent kinase 9
naked mole-rat(101722666) cyclin-dependent kinase 9
domestic guinea pig(100725846) cyclin-dependent kinase 9
sheep(101109788) cyclin-dependent kinase 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107852 Anti-CDK9 antibody produced in rabbit IgG fraction of antiserum rat, pig, human, bovine, canine, mouse, zebrafish
western blot pricing
HPA006738 Anti-CDK9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV03004 Anti-CDK9 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder human, zebrafish, bovine, rat, pig, canine, mouse
western blot pricing
SAB2103317 Anti-CDK9, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1302233 ANTI-MOUSE CDK9 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB4504223 Anti-phospho-CDK9 (pThr186) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB5300326 Monoclonal Anti-CDK9 antibody produced in mouse clone 1B5A7, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300327 Monoclonal Anti-CDK9 antibody produced in mouse clone 1B5D10, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB1402145 Monoclonal Anti-CDK9, (C-terminal) antibody produced in mouse clone 2D7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0281 Rabbit anti-CDK9 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. bovine, dog, primate, rat, horse, rhesus monkey, guinea pig, human, mouse, pig, gorilla
immunoprecipitation, proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
O0886 Olomoucine ≥98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001261 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053481 MISSION® esiRNA esiRNA human CDK9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001261 siRNAs that have been validated in the lab human pricing
NM_001007743 Rosetta Predictions rat pricing
NM_130860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001261 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112403 validated 572
1 SASI_Hs01_00112404 validated 924
2 SASI_Hs01_00112405 predicted 873
3 SASI_Hs01_00112406 predicted 668
4 SASI_Hs01_00112407 predicted 878
5 SASI_Hs01_00112408 predicted 518
6 SASI_Hs01_00112409 predicted 414
7 SASI_Hs01_00112410 predicted 402
8 SASI_Hs01_00112411 predicted 1039
9 SASI_Hs01_00112412 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104655 predicted 807
2 SASI_Rn01_00104656 predicted 1225
3 SASI_Rn02_00198934 predicted 228
4 SASI_Rn02_00198935 predicted 524
5 SASI_Rn02_00198936 predicted 1134
6 SASI_Rn01_00104657 predicted 296
7 SASI_Rn01_00104658 predicted 331
8 SASI_Rn01_00104659 predicted 1028
9 SASI_Rn01_00104660 predicted 1433
10 SASI_Rn01_00104661 predicted 1023
11 SASI_Rn01_00104662 predicted 1113
12 SASI_Rn01_00104663 predicted 723
13 SASI_Rn01_00104664 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074189 predicted 1306
2 SASI_Mm01_00074190 predicted 894
3 SASI_Mm01_00074191 predicted 1305
4 SASI_Mm01_00074192 predicted 1434
5 SASI_Mm01_00074193 predicted 351
6 SASI_Mm01_00074194 predicted 385
7 SASI_Mm01_00074195 predicted 358
8 SASI_Mm01_00074196 predicted 467
9 SASI_Mm01_00074197 predicted 800
10 SASI_Mm01_00074198 predicted 1109
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001261
VALIDATED
CDK9 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 9
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-404s1c1
Sequence:CCGGGTTCGACTTCTGCGAGCATGACTCGAGTCATGCTCGCAGAAGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-1262s1c1
Sequence:CCGGCTATGTGACTTGCATCGTGGACTCGAGTCCACGATGCAAGTCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-858s1c1
Sequence:CCGGCCAAACGTGGACAACTATGAGCTCGAGCTCATAGTTGTCCACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-141s1c1
Sequence:CCGGGAAGTTTCCAAATACGAGAAGCTCGAGCTTCTCGTATTTGGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-1094s1c1
Sequence:CCGGGACGTCCATGTTCGAGTACTTCTCGAGAAGTACTCGAACATGGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001261.2-960s1c1
Sequence:CCGGGCACTGGACCTCATCGACAAGCTCGAGCTTGTCGATGAGGTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001261.2-429s1c1
Sequence:CCGGGCTGGGCTGTTGAGCAATGTTCTCGAGAACATTGCTCAACAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.x-340s1c1
Sequence:CCGGTGATTGAGATTTGTCGAACCACTCGAGTGGTTCGACAAATCTCAATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.x-1712s1c1
Sequence:CCGGGCACAGTTTGGTCCGTTAGAACTCGAGTTCTAACGGACCAAACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.x-509s1c1
Sequence:CCGGCTACTACATCCACAGAAACAACTCGAGTTGTTTCTGTGGATGTAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001261.3-883s21c1
Sequence:CCGGCCAAACGTGGACAACTATGAGCTCGAGCTCATAGTTGTCCACGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001261.3-565s21c1
Sequence:CCGGAGGGACATGAAGGCTGCTAATCTCGAGATTAGCAGCCTTCATGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001261.3-1737s21c1
Sequence:CCGGGCACAGTTTGGTCCGTTAGAACTCGAGTTCTAACGGACCAAACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001261.3-534s21c1
Sequence:CCGGCTACTACATCCACAGAAACAACTCGAGTTGTTTCTGTGGATGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001261
VALIDATED
CDK9 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 9
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-404s1c1
Sequence:CCGGGTTCGACTTCTGCGAGCATGACTCGAGTCATGCTCGCAGAAGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-1262s1c1
Sequence:CCGGCTATGTGACTTGCATCGTGGACTCGAGTCCACGATGCAAGTCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-858s1c1
Sequence:CCGGCCAAACGTGGACAACTATGAGCTCGAGCTCATAGTTGTCCACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-141s1c1
Sequence:CCGGGAAGTTTCCAAATACGAGAAGCTCGAGCTTCTCGTATTTGGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-1094s1c1
Sequence:CCGGGACGTCCATGTTCGAGTACTTCTCGAGAAGTACTCGAACATGGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001261.2-960s1c1
Sequence:CCGGGCACTGGACCTCATCGACAAGCTCGAGCTTGTCGATGAGGTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001261.2-429s1c1
Sequence:CCGGGCTGGGCTGTTGAGCAATGTTCTCGAGAACATTGCTCAACAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.x-340s1c1
Sequence:CCGGTGATTGAGATTTGTCGAACCACTCGAGTGGTTCGACAAATCTCAATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.x-1712s1c1
Sequence:CCGGGCACAGTTTGGTCCGTTAGAACTCGAGTTCTAACGGACCAAACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.x-509s1c1
Sequence:CCGGCTACTACATCCACAGAAACAACTCGAGTTGTTTCTGTGGATGTAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001261.3-883s21c1
Sequence:CCGGCCAAACGTGGACAACTATGAGCTCGAGCTCATAGTTGTCCACGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001261.3-565s21c1
Sequence:CCGGAGGGACATGAAGGCTGCTAATCTCGAGATTAGCAGCCTTCATGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001261.3-1737s21c1
Sequence:CCGGGCACAGTTTGGTCCGTTAGAACTCGAGTTCTAACGGACCAAACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001261.3-534s21c1
Sequence:CCGGCTACTACATCCACAGAAACAACTCGAGTTGTTTCTGTGGATGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001261
VALIDATED
CDK9 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 9
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-404s1c1
Sequence:CCGGGTTCGACTTCTGCGAGCATGACTCGAGTCATGCTCGCAGAAGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-1262s1c1
Sequence:CCGGCTATGTGACTTGCATCGTGGACTCGAGTCCACGATGCAAGTCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-858s1c1
Sequence:CCGGCCAAACGTGGACAACTATGAGCTCGAGCTCATAGTTGTCCACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-141s1c1
Sequence:CCGGGAAGTTTCCAAATACGAGAAGCTCGAGCTTCTCGTATTTGGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.2-1094s1c1
Sequence:CCGGGACGTCCATGTTCGAGTACTTCTCGAGAAGTACTCGAACATGGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001261.2-960s1c1
Sequence:CCGGGCACTGGACCTCATCGACAAGCTCGAGCTTGTCGATGAGGTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001261.2-429s1c1
Sequence:CCGGGCTGGGCTGTTGAGCAATGTTCTCGAGAACATTGCTCAACAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.x-340s1c1
Sequence:CCGGTGATTGAGATTTGTCGAACCACTCGAGTGGTTCGACAAATCTCAATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.x-1712s1c1
Sequence:CCGGGCACAGTTTGGTCCGTTAGAACTCGAGTTCTAACGGACCAAACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001261.x-509s1c1
Sequence:CCGGCTACTACATCCACAGAAACAACTCGAGTTGTTTCTGTGGATGTAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001261.3-883s21c1
Sequence:CCGGCCAAACGTGGACAACTATGAGCTCGAGCTCATAGTTGTCCACGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001261.3-565s21c1
Sequence:CCGGAGGGACATGAAGGCTGCTAATCTCGAGATTAGCAGCCTTCATGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001261.3-1737s21c1
Sequence:CCGGGCACAGTTTGGTCCGTTAGAACTCGAGTTCTAACGGACCAAACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001261.3-534s21c1
Sequence:CCGGCTACTACATCCACAGAAACAACTCGAGTTGTTTCTGTGGATGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130860
VALIDATED
CDK9 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 9
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130860.1-421s1c1
Sequence:CCGGCGTCTTAGTCAAGTTCACGTTCTCGAGAACGTGAACTTGACTAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130860.1-127s1c1
Sequence:CCGGGTACGAGAAACTTGCCAAGATCTCGAGATCTTGGCAAGTTTCTCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130860.1-1170s1c1
Sequence:CCGGCGGAATTTGAACGTGTCTTCTCTCGAGAGAAGACACGTTCAAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130860.1-296s1c1
Sequence:CCGGCATGAGAATGTGGTGAACCTACTCGAGTAGGTTCACCACATTCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130860.1-839s1c1
Sequence:CCGGGTAGACAAGTATGAGCTGTTTCTCGAGAAACAGCTCATACTTGTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-884s21c1
Sequence:CCGGGTGGCCAAACGTAGACAAGTACTCGAGTACTTGTCTACGTTTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-947s21c1
Sequence:CCGGGAAGGTGAAGGACCGTCTGAACTCGAGTTCAGACGGTCCTTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-498s21c1
Sequence:CCGGTCTGAGATCAAGAGAGTGATGCTCGAGCATCACTCTCTTGATCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-985s21c1
Sequence:CCGGCCTATGCTCTGGACCTCATTGCTCGAGCAATGAGGTCCAGAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-527s21c1
Sequence:CCGGGCTGAACGGCCTCTACTACATCTCGAGATGTAGTAGAGGCCGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-646s21c1
Sequence:CCGGCCTTCAGCCTAGCTAAGAATACTCGAGTATTCTTAGCTAGGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130860
VALIDATED
CDK9 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 9
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130860.1-421s1c1
Sequence:CCGGCGTCTTAGTCAAGTTCACGTTCTCGAGAACGTGAACTTGACTAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130860.1-127s1c1
Sequence:CCGGGTACGAGAAACTTGCCAAGATCTCGAGATCTTGGCAAGTTTCTCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130860.1-1170s1c1
Sequence:CCGGCGGAATTTGAACGTGTCTTCTCTCGAGAGAAGACACGTTCAAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130860.1-296s1c1
Sequence:CCGGCATGAGAATGTGGTGAACCTACTCGAGTAGGTTCACCACATTCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130860.1-839s1c1
Sequence:CCGGGTAGACAAGTATGAGCTGTTTCTCGAGAAACAGCTCATACTTGTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-884s21c1
Sequence:CCGGGTGGCCAAACGTAGACAAGTACTCGAGTACTTGTCTACGTTTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-947s21c1
Sequence:CCGGGAAGGTGAAGGACCGTCTGAACTCGAGTTCAGACGGTCCTTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-498s21c1
Sequence:CCGGTCTGAGATCAAGAGAGTGATGCTCGAGCATCACTCTCTTGATCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-985s21c1
Sequence:CCGGCCTATGCTCTGGACCTCATTGCTCGAGCAATGAGGTCCAGAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-527s21c1
Sequence:CCGGGCTGAACGGCCTCTACTACATCTCGAGATGTAGTAGAGGCCGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-646s21c1
Sequence:CCGGCCTTCAGCCTAGCTAAGAATACTCGAGTATTCTTAGCTAGGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130860
VALIDATED
CDK9 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 9
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130860.1-421s1c1
Sequence:CCGGCGTCTTAGTCAAGTTCACGTTCTCGAGAACGTGAACTTGACTAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_130860.1-127s1c1
Sequence:CCGGGTACGAGAAACTTGCCAAGATCTCGAGATCTTGGCAAGTTTCTCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130860.1-1170s1c1
Sequence:CCGGCGGAATTTGAACGTGTCTTCTCTCGAGAGAAGACACGTTCAAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130860.1-296s1c1
Sequence:CCGGCATGAGAATGTGGTGAACCTACTCGAGTAGGTTCACCACATTCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130860.1-839s1c1
Sequence:CCGGGTAGACAAGTATGAGCTGTTTCTCGAGAAACAGCTCATACTTGTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-884s21c1
Sequence:CCGGGTGGCCAAACGTAGACAAGTACTCGAGTACTTGTCTACGTTTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-947s21c1
Sequence:CCGGGAAGGTGAAGGACCGTCTGAACTCGAGTTCAGACGGTCCTTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-498s21c1
Sequence:CCGGTCTGAGATCAAGAGAGTGATGCTCGAGCATCACTCTCTTGATCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-985s21c1
Sequence:CCGGCCTATGCTCTGGACCTCATTGCTCGAGCAATGAGGTCCAGAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-527s21c1
Sequence:CCGGGCTGAACGGCCTCTACTACATCTCGAGATGTAGTAGAGGCCGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130860.3-646s21c1
Sequence:CCGGCCTTCAGCCTAGCTAAGAATACTCGAGTATTCTTAGCTAGGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks