EMAIL THIS PAGE TO A FRIEND

CDKAL1

CDK5 regulatory subunit associated protein 1-like 1

119 Gene Product Result for
UniProtKB ID: Q5VV42, A8K6S0, Q6P385, Q6ZR27, Q9NXB3
Gene ID:
Human(54901) Summary: The protein encoded by this gene is a member of the methylthiotransferase family. The function of this gene is not known. Genome-wide association studies have linked single nucleotide polymorphisms in an intron of this gene with susceptibilty to type 2 diabetes. [provided by RefSeq, May 2010]
Mouse(68916) CDK5 regulatory subunit associated protein 1-like 1
Rat(361243) CDK5 regulatory subunit associated protein 1-like 1
Zebrafish(393600) CDK5 regulatory subunit associated protein 1-like 1
cow(530159) CDK5 regulatory subunit associated protein 1-like 1
Horse(100052309) CDK5 regulatory subunit associated protein 1-like 1
domestic cat(101098791) CDK5 regulatory subunit associated protein 1-like 1
dog(488240) CDK5 regulatory subunit associated protein 1-like 1
chicken(420823) CDK5 regulatory subunit associated protein 1-like 1
sheep(101121212) CDK5 regulatory subunit associated protein 1-like 1
domestic guinea pig(100732657) CDK5 regulatory subunit associated protein 1-like 1
naked mole-rat(101698350) CDK5 regulatory subunit associated protein 1-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017774 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144536 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144536 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144536 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017774 Rosetta Predictions human pricing
NM_001108413 Rosetta Predictions rat pricing
NM_144536 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035856 predicted 745
2 SASI_Hs01_00035859 predicted 962
3 SASI_Hs01_00035860 predicted 767
4 SASI_Hs01_00035861 predicted 643
5 SASI_Hs01_00035862 predicted 1177
6 SASI_Hs02_00350612 predicted 340
7 SASI_Hs01_00035863 predicted 1662
8 SASI_Hs01_00035864 predicted 1333
9 SASI_Hs02_00350613 predicted 1591
10 SASI_Hs01_00035865 predicted 879
11 SASI_Hs01_00035857 predicted 794
12 SASI_Hs01_00035858 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238419 predicted 236
2 SASI_Rn02_00238420 predicted 450
3 SASI_Rn02_00238421 predicted 196
4 SASI_Rn02_00238422 predicted 293
5 SASI_Rn02_00238423 predicted 208
6 SASI_Rn02_00238424 predicted 209
7 SASI_Rn02_00238425 predicted 305
8 SASI_Rn02_00238426 predicted 349
9 SASI_Rn02_00238427 predicted 194
10 SASI_Rn02_00238428 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026075 predicted 810
2 SASI_Mm01_00026077 predicted 1806
3 SASI_Mm02_00340068 predicted 349
4 SASI_Mm01_00026078 predicted 656
5 SASI_Mm01_00026079 predicted 541
6 SASI_Mm01_00026080 predicted 382
7 SASI_Mm01_00026082 predicted 235
8 SASI_Mm02_00340069 predicted 435
9 SASI_Mm01_00026083 predicted 795
10 SASI_Mm01_00026084 predicted 1137
11 SASI_Mm01_00026076 predicted 751
12 SASI_Mm01_00026081 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017774
VALIDATED
CDKAL1 MISSION shRNA Bacterial Glycerol Stock
CDK5 regulatory subunit associated protein 1-like 1
Human
24 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-956s21c1
Sequence:CCGGGGGCTTATGGCAGAGATATTGCTCGAGCAATATCTCTGCCATAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017774.2-2122s21c1
Sequence:CCGGACCATAGCACATCCTTCAAATCTCGAGATTTGAAGGATGTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-433s21c1
Sequence:CCGGCTAGCTGCTTATGGCTATAAACTCGAGTTTATAGCCATAAGCAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-860s21c1
Sequence:CCGGATTTGGCCAGTTATCCAATTGCTCGAGCAATTGGATAACTGGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-620s21c1
Sequence:CCGGTTAAGGGACTGAGTATCATTGCTCGAGCAATGATACTCAGTCCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-2087s21c1
Sequence:CCGGCCATTGGTTATTTGACCTAAACTCGAGTTTAGGTCAAATAACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017774.2-1992s21c1
Sequence:CCGGCCATTCTCCAAGGGCAATAATCTCGAGATTATTGCCCTTGGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-1527s21c1
Sequence:CCGGTTATGTTGCACACAATCAATTCTCGAGAATTGATTGTGTGCAACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-523s21c1
Sequence:CCGGGACCACTTTAGAAACTCAATTCTCGAGAATTGAGTTTCTAAAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-1243s21c1
Sequence:CCGGACTATTGCTACAGATATTATCCTCGAGGATAATATCTGTAGCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-464s21c1
Sequence:CCGGATGCATCCGATGCAGATTTATCTCGAGATAAATCTGCATCGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-669s21c1
Sequence:CCGGAGTTGTGGAGGAGACAATTAACTCGAGTTAATTGTCTCCTCCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-1611s21c1
Sequence:CCGGCTATGAATCAGGCAAACATTTCTCGAGAAATGTTTGCCTGATTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-1336s21c1
Sequence:CCGGAGCCTGTTTATTAACCAATTTCTCGAGAAATTGGTTAATAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-280s21c1
Sequence:CCGGCCGAAGGTACGAAGGCGAAATCTCGAGATTTCGCCTTCGTACCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-752s21c1
Sequence:CCGGGATTGGATTTGCCGAAGATTACTCGAGTAATCTTCGGCAAATCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017774.2-1922s21c1
Sequence:CCGGCTAATGGAAACATCTATAAAGCTCGAGCTTTATAGATGTTTCCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-1048s21c1
Sequence:CCGGATGACAAATCCGCCCTATATTCTCGAGAATATAGGGCGGATTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-1311s21c1
Sequence:CCGGACTTGTTGAAGAGTACAAATTCTCGAGAATTTGTACTCTTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017774.1-977s1c1
Sequence:CCGGGCATGACAAATCCGCCCTATACTCGAGTATAGGGCGGATTTGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017774.1-212s1c1
Sequence:CCGGCGAAGGTACGAAGGCGAAATACTCGAGTATTTCGCCTTCGTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017774.1-1537s1c1
Sequence:CCGGGACATCTATGAATCAGGCAAACTCGAGTTTGCCTGATTCATAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017774.1-420s1c1
Sequence:CCGGCCTGAACAGTTGCACTGTAAACTCGAGTTTACAGTGCAACTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017774.1-682s1c1
Sequence:CCGGCGATTGGATTTGCCGAAGATTCTCGAGAATCTTCGGCAAATCCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017774
VALIDATED
CDKAL1 MISSION shRNA shRNA Plasmid DNA
CDK5 regulatory subunit associated protein 1-like 1
Human
24 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-956s21c1
Sequence:CCGGGGGCTTATGGCAGAGATATTGCTCGAGCAATATCTCTGCCATAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017774.2-2122s21c1
Sequence:CCGGACCATAGCACATCCTTCAAATCTCGAGATTTGAAGGATGTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-433s21c1
Sequence:CCGGCTAGCTGCTTATGGCTATAAACTCGAGTTTATAGCCATAAGCAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-860s21c1
Sequence:CCGGATTTGGCCAGTTATCCAATTGCTCGAGCAATTGGATAACTGGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-620s21c1
Sequence:CCGGTTAAGGGACTGAGTATCATTGCTCGAGCAATGATACTCAGTCCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-2087s21c1
Sequence:CCGGCCATTGGTTATTTGACCTAAACTCGAGTTTAGGTCAAATAACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017774.2-1992s21c1
Sequence:CCGGCCATTCTCCAAGGGCAATAATCTCGAGATTATTGCCCTTGGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-1527s21c1
Sequence:CCGGTTATGTTGCACACAATCAATTCTCGAGAATTGATTGTGTGCAACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-523s21c1
Sequence:CCGGGACCACTTTAGAAACTCAATTCTCGAGAATTGAGTTTCTAAAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-1243s21c1
Sequence:CCGGACTATTGCTACAGATATTATCCTCGAGGATAATATCTGTAGCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-464s21c1
Sequence:CCGGATGCATCCGATGCAGATTTATCTCGAGATAAATCTGCATCGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-669s21c1
Sequence:CCGGAGTTGTGGAGGAGACAATTAACTCGAGTTAATTGTCTCCTCCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-1611s21c1
Sequence:CCGGCTATGAATCAGGCAAACATTTCTCGAGAAATGTTTGCCTGATTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-1336s21c1
Sequence:CCGGAGCCTGTTTATTAACCAATTTCTCGAGAAATTGGTTAATAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-280s21c1
Sequence:CCGGCCGAAGGTACGAAGGCGAAATCTCGAGATTTCGCCTTCGTACCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-752s21c1
Sequence:CCGGGATTGGATTTGCCGAAGATTACTCGAGTAATCTTCGGCAAATCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017774.2-1922s21c1
Sequence:CCGGCTAATGGAAACATCTATAAAGCTCGAGCTTTATAGATGTTTCCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-1048s21c1
Sequence:CCGGATGACAAATCCGCCCTATATTCTCGAGAATATAGGGCGGATTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-1311s21c1
Sequence:CCGGACTTGTTGAAGAGTACAAATTCTCGAGAATTTGTACTCTTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017774.1-977s1c1
Sequence:CCGGGCATGACAAATCCGCCCTATACTCGAGTATAGGGCGGATTTGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017774.1-212s1c1
Sequence:CCGGCGAAGGTACGAAGGCGAAATACTCGAGTATTTCGCCTTCGTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017774.1-1537s1c1
Sequence:CCGGGACATCTATGAATCAGGCAAACTCGAGTTTGCCTGATTCATAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017774.1-420s1c1
Sequence:CCGGCCTGAACAGTTGCACTGTAAACTCGAGTTTACAGTGCAACTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017774.1-682s1c1
Sequence:CCGGCGATTGGATTTGCCGAAGATTCTCGAGAATCTTCGGCAAATCCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017774
VALIDATED
CDKAL1 MISSION shRNA Lentiviral Transduction Particles
CDK5 regulatory subunit associated protein 1-like 1
Human
24 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-956s21c1
Sequence:CCGGGGGCTTATGGCAGAGATATTGCTCGAGCAATATCTCTGCCATAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017774.2-2122s21c1
Sequence:CCGGACCATAGCACATCCTTCAAATCTCGAGATTTGAAGGATGTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-433s21c1
Sequence:CCGGCTAGCTGCTTATGGCTATAAACTCGAGTTTATAGCCATAAGCAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-860s21c1
Sequence:CCGGATTTGGCCAGTTATCCAATTGCTCGAGCAATTGGATAACTGGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-620s21c1
Sequence:CCGGTTAAGGGACTGAGTATCATTGCTCGAGCAATGATACTCAGTCCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-2087s21c1
Sequence:CCGGCCATTGGTTATTTGACCTAAACTCGAGTTTAGGTCAAATAACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017774.2-1992s21c1
Sequence:CCGGCCATTCTCCAAGGGCAATAATCTCGAGATTATTGCCCTTGGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-1527s21c1
Sequence:CCGGTTATGTTGCACACAATCAATTCTCGAGAATTGATTGTGTGCAACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-523s21c1
Sequence:CCGGGACCACTTTAGAAACTCAATTCTCGAGAATTGAGTTTCTAAAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-1243s21c1
Sequence:CCGGACTATTGCTACAGATATTATCCTCGAGGATAATATCTGTAGCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-464s21c1
Sequence:CCGGATGCATCCGATGCAGATTTATCTCGAGATAAATCTGCATCGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017774.2-669s21c1
Sequence:CCGGAGTTGTGGAGGAGACAATTAACTCGAGTTAATTGTCTCCTCCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-1611s21c1
Sequence:CCGGCTATGAATCAGGCAAACATTTCTCGAGAAATGTTTGCCTGATTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-1336s21c1
Sequence:CCGGAGCCTGTTTATTAACCAATTTCTCGAGAAATTGGTTAATAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-280s21c1
Sequence:CCGGCCGAAGGTACGAAGGCGAAATCTCGAGATTTCGCCTTCGTACCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-752s21c1
Sequence:CCGGGATTGGATTTGCCGAAGATTACTCGAGTAATCTTCGGCAAATCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017774.2-1922s21c1
Sequence:CCGGCTAATGGAAACATCTATAAAGCTCGAGCTTTATAGATGTTTCCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-1048s21c1
Sequence:CCGGATGACAAATCCGCCCTATATTCTCGAGAATATAGGGCGGATTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017774.2-1311s21c1
Sequence:CCGGACTTGTTGAAGAGTACAAATTCTCGAGAATTTGTACTCTTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017774.1-977s1c1
Sequence:CCGGGCATGACAAATCCGCCCTATACTCGAGTATAGGGCGGATTTGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017774.1-212s1c1
Sequence:CCGGCGAAGGTACGAAGGCGAAATACTCGAGTATTTCGCCTTCGTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017774.1-1537s1c1
Sequence:CCGGGACATCTATGAATCAGGCAAACTCGAGTTTGCCTGATTCATAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017774.1-420s1c1
Sequence:CCGGCCTGAACAGTTGCACTGTAAACTCGAGTTTACAGTGCAACTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017774.1-682s1c1
Sequence:CCGGCGATTGGATTTGCCGAAGATTCTCGAGAATCTTCGGCAAATCCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144536
VALIDATED
CDKAL1 MISSION shRNA Bacterial Glycerol Stock
CDK5 regulatory subunit associated protein 1-like 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144536.2-1134s21c1
Sequence:CCGGTAACGATTGCTACGGATATTACTCGAGTAATATCCGTAGCAATCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144536.2-941s21c1
Sequence:CCGGATGACAAATCCACCATATATTCTCGAGAATATATGGTGGATTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144536.2-325s21c1
Sequence:CCGGGCTTGCTGCCTATGGCTATAACTCGAGTTATAGCCATAGGCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144536.2-2206s21c1
Sequence:CCGGAGAACATCCAGCCCTTAATAACTCGAGTTATTAAGGGCTGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144536.2-1675s21c1
Sequence:CCGGTCAGCATGGCTCTGCGTATTCCTCGAGGAATACGCAGAGCCATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144536.2-326s1c1
Sequence:CCGGCTTGCTGCCTATGGCTATAAACTCGAGTTTATAGCCATAGGCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144536.1-227s1c1
Sequence:CCGGCCACCAAGTGACAGCACTATTCTCGAGAATAGTGCTGTCACTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144536.1-1817s1c1
Sequence:CCGGGCCTCCATAAGGAATAAGTTTCTCGAGAAACTTATTCCTTATGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144536.1-418s1c1
Sequence:CCGGCCACTTTAGAAACTCAATCAACTCGAGTTGATTGAGTTTCTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144536.1-176s1c1
Sequence:CCGGCCTAAAGTACGAAGGCGGAATCTCGAGATTCCGCCTTCGTACTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144536.1-939s1c1
Sequence:CCGGGCATGACAAATCCACCATATACTCGAGTATATGGTGGATTTGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144536
VALIDATED
CDKAL1 MISSION shRNA shRNA Plasmid DNA
CDK5 regulatory subunit associated protein 1-like 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144536.2-1134s21c1
Sequence:CCGGTAACGATTGCTACGGATATTACTCGAGTAATATCCGTAGCAATCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144536.2-941s21c1
Sequence:CCGGATGACAAATCCACCATATATTCTCGAGAATATATGGTGGATTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144536.2-325s21c1
Sequence:CCGGGCTTGCTGCCTATGGCTATAACTCGAGTTATAGCCATAGGCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144536.2-2206s21c1
Sequence:CCGGAGAACATCCAGCCCTTAATAACTCGAGTTATTAAGGGCTGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144536.2-1675s21c1
Sequence:CCGGTCAGCATGGCTCTGCGTATTCCTCGAGGAATACGCAGAGCCATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144536.2-326s1c1
Sequence:CCGGCTTGCTGCCTATGGCTATAAACTCGAGTTTATAGCCATAGGCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144536.1-227s1c1
Sequence:CCGGCCACCAAGTGACAGCACTATTCTCGAGAATAGTGCTGTCACTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144536.1-1817s1c1
Sequence:CCGGGCCTCCATAAGGAATAAGTTTCTCGAGAAACTTATTCCTTATGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144536.1-418s1c1
Sequence:CCGGCCACTTTAGAAACTCAATCAACTCGAGTTGATTGAGTTTCTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144536.1-176s1c1
Sequence:CCGGCCTAAAGTACGAAGGCGGAATCTCGAGATTCCGCCTTCGTACTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144536.1-939s1c1
Sequence:CCGGGCATGACAAATCCACCATATACTCGAGTATATGGTGGATTTGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144536
VALIDATED
CDKAL1 MISSION shRNA Lentiviral Transduction Particles
CDK5 regulatory subunit associated protein 1-like 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144536.2-1134s21c1
Sequence:CCGGTAACGATTGCTACGGATATTACTCGAGTAATATCCGTAGCAATCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144536.2-941s21c1
Sequence:CCGGATGACAAATCCACCATATATTCTCGAGAATATATGGTGGATTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144536.2-325s21c1
Sequence:CCGGGCTTGCTGCCTATGGCTATAACTCGAGTTATAGCCATAGGCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144536.2-2206s21c1
Sequence:CCGGAGAACATCCAGCCCTTAATAACTCGAGTTATTAAGGGCTGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144536.2-1675s21c1
Sequence:CCGGTCAGCATGGCTCTGCGTATTCCTCGAGGAATACGCAGAGCCATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144536.2-326s1c1
Sequence:CCGGCTTGCTGCCTATGGCTATAAACTCGAGTTTATAGCCATAGGCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144536.1-227s1c1
Sequence:CCGGCCACCAAGTGACAGCACTATTCTCGAGAATAGTGCTGTCACTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144536.1-1817s1c1
Sequence:CCGGGCCTCCATAAGGAATAAGTTTCTCGAGAAACTTATTCCTTATGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144536.1-418s1c1
Sequence:CCGGCCACTTTAGAAACTCAATCAACTCGAGTTGATTGAGTTTCTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144536.1-176s1c1
Sequence:CCGGCCTAAAGTACGAAGGCGGAATCTCGAGATTCCGCCTTCGTACTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144536.1-939s1c1
Sequence:CCGGGCATGACAAATCCACCATATACTCGAGTATATGGTGGATTTGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks