EMAIL THIS PAGE TO A FRIEND

CDKL1

cyclin-dependent kinase-like 1 (CDC2-related kinase)

62 Gene Product Result for
Synonyms: KKIALRE P42
UniProtKB ID: Q00532, Q2M3A4, Q6QUA0, Q8WXQ5
Gene ID:
Human(8814) Summary: This gene product is a member of a large family of CDC2-related serine/threonine protein kinases. It accumulates primarily in the nucleus. Alternative splice variants encoding different protein isoforms have been described, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(71091) cyclin-dependent kinase-like 1 (CDC2-related kinase)
Rat(314198) cyclin-dependent kinase-like 1 (CDC2-related kinase)
Zebrafish(445316) cyclin-dependent kinase-like 1 (CDC2-related kinase)
chicken(423575) cyclin-dependent kinase-like 1 (CDC2-related kinase)
dog(480317) cyclin-dependent kinase-like 1 (CDC2-related kinase)
domestic cat(101094603) cyclin-dependent kinase-like 1 (CDC2-related kinase)
Horse(100066398) cyclin-dependent kinase-like 1 (CDC2-related kinase)
cow(523900) cyclin-dependent kinase-like 1 (CDC2-related kinase)
naked mole-rat(101700321) cyclin-dependent kinase-like 1 (CDC2-related kinase)
domestic guinea pig(100727504) cyclin-dependent kinase-like 1 (CDC2-related kinase)
sheep(101103157) cyclin-dependent kinase-like 1 (CDC2-related kinase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004196 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183294 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183294 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183294 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004196 Rosetta Predictions human pricing
NM_001025121 Rosetta Predictions rat pricing
NM_183294 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337092 predicted 245
2 SASI_Hs01_00236012 predicted 488
3 SASI_Hs01_00236013 predicted 356
4 SASI_Hs01_00236014 predicted 289
5 SASI_Hs01_00236015 predicted 517
6 SASI_Hs01_00236016 predicted 442
7 SASI_Hs01_00236018 predicted 844
8 SASI_Hs01_00236019 predicted 705
9 SASI_Hs01_00236020 predicted 429
10 SASI_Hs02_00337093 predicted 943
11 SASI_Hs01_00236011 predicted 651
12 SASI_Hs01_00236017 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203020 predicted 198
2 SASI_Rn02_00203021 predicted 1134
3 SASI_Rn02_00203022 predicted 443
4 SASI_Rn02_00203023 predicted 942
5 SASI_Rn02_00203024 predicted 778
6 SASI_Rn02_00203025 predicted 503
7 SASI_Rn02_00203026 predicted 1169
8 SASI_Rn02_00203027 predicted 565
9 SASI_Rn02_00203028 predicted 730
10 SASI_Rn02_00203029 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183294 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124279 predicted 845
2 SASI_Mm01_00124280 predicted 905
3 SASI_Mm01_00124281 predicted 499
4 SASI_Mm01_00124282 predicted 279
5 SASI_Mm01_00124283 predicted 795
6 SASI_Mm01_00124284 predicted 941
7 SASI_Mm01_00124285 predicted 742
8 SASI_Mm01_00124286 predicted 1013
9 SASI_Mm01_00124287 predicted 461
10 SASI_Mm01_00124288 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004196
CDKL1 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase-like 1 (CDC2-related kinase)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004196.3-111s1c1
Sequence:CCGGGTCAGATTGTGGCCATCAAGACTCGAGTCTTGATGGCCACAATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004196.3-845s1c1
Sequence:CCGGCCTACTCAAAGGCTGACATGTCTCGAGACATGTCAGCCTTTGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004196.3-990s1c1
Sequence:CCGGCATCCAAGTTGCAGTACCTACCTCGAGGTAGGTACTGCAACTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-706s1c1
Sequence:CCGGCCAGCAAGTGTTTAGCACGAACTCGAGTTCGTGCTAAACACTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-575s1c1
Sequence:CCGGCCGGTGGATGTTTGGGCAATTCTCGAGAATTGCCCAAACATCCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-758s1c1
Sequence:CCGGCCTGAAGATATGGAACCACTTCTCGAGAAGTGGTTCCATATCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-122s1c1
Sequence:CCGGGCCATCAAGAAGTTTCTGGAACTCGAGTTCCAGAAACTTCTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-433s1c1
Sequence:CCGGCACGAAACATTCCGTGATTAACTCGAGTTAATCACGGAATGTTTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004196.3-486s21c1
Sequence:CCGGCTGGACCGAGTGACTACTATACTCGAGTATAGTAGTCACTCGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004196.3-871s21c1
Sequence:CCGGGCTGTTGCATCACCCATATTTCTCGAGAAATATGGGTGATGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004196.3-434s21c1
Sequence:CCGGACGAAACATTCCGTGATTAAGCTCGAGCTTAATCACGGAATGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004196.3-835s21c1
Sequence:CCGGCCACATGGACCCTACTCAAAGCTCGAGCTTTGAGTAGGGTCCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004196
CDKL1 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase-like 1 (CDC2-related kinase)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004196.3-111s1c1
Sequence:CCGGGTCAGATTGTGGCCATCAAGACTCGAGTCTTGATGGCCACAATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004196.3-845s1c1
Sequence:CCGGCCTACTCAAAGGCTGACATGTCTCGAGACATGTCAGCCTTTGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004196.3-990s1c1
Sequence:CCGGCATCCAAGTTGCAGTACCTACCTCGAGGTAGGTACTGCAACTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-706s1c1
Sequence:CCGGCCAGCAAGTGTTTAGCACGAACTCGAGTTCGTGCTAAACACTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-575s1c1
Sequence:CCGGCCGGTGGATGTTTGGGCAATTCTCGAGAATTGCCCAAACATCCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-758s1c1
Sequence:CCGGCCTGAAGATATGGAACCACTTCTCGAGAAGTGGTTCCATATCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-122s1c1
Sequence:CCGGGCCATCAAGAAGTTTCTGGAACTCGAGTTCCAGAAACTTCTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-433s1c1
Sequence:CCGGCACGAAACATTCCGTGATTAACTCGAGTTAATCACGGAATGTTTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004196.3-486s21c1
Sequence:CCGGCTGGACCGAGTGACTACTATACTCGAGTATAGTAGTCACTCGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004196.3-871s21c1
Sequence:CCGGGCTGTTGCATCACCCATATTTCTCGAGAAATATGGGTGATGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004196.3-434s21c1
Sequence:CCGGACGAAACATTCCGTGATTAAGCTCGAGCTTAATCACGGAATGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004196.3-835s21c1
Sequence:CCGGCCACATGGACCCTACTCAAAGCTCGAGCTTTGAGTAGGGTCCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004196
CDKL1 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase-like 1 (CDC2-related kinase)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004196.3-111s1c1
Sequence:CCGGGTCAGATTGTGGCCATCAAGACTCGAGTCTTGATGGCCACAATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004196.3-845s1c1
Sequence:CCGGCCTACTCAAAGGCTGACATGTCTCGAGACATGTCAGCCTTTGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004196.3-990s1c1
Sequence:CCGGCATCCAAGTTGCAGTACCTACCTCGAGGTAGGTACTGCAACTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-706s1c1
Sequence:CCGGCCAGCAAGTGTTTAGCACGAACTCGAGTTCGTGCTAAACACTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-575s1c1
Sequence:CCGGCCGGTGGATGTTTGGGCAATTCTCGAGAATTGCCCAAACATCCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-758s1c1
Sequence:CCGGCCTGAAGATATGGAACCACTTCTCGAGAAGTGGTTCCATATCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-122s1c1
Sequence:CCGGGCCATCAAGAAGTTTCTGGAACTCGAGTTCCAGAAACTTCTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004196.3-433s1c1
Sequence:CCGGCACGAAACATTCCGTGATTAACTCGAGTTAATCACGGAATGTTTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004196.3-486s21c1
Sequence:CCGGCTGGACCGAGTGACTACTATACTCGAGTATAGTAGTCACTCGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004196.3-871s21c1
Sequence:CCGGGCTGTTGCATCACCCATATTTCTCGAGAAATATGGGTGATGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004196.3-434s21c1
Sequence:CCGGACGAAACATTCCGTGATTAAGCTCGAGCTTAATCACGGAATGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004196.3-835s21c1
Sequence:CCGGCCACATGGACCCTACTCAAAGCTCGAGCTTTGAGTAGGGTCCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183294
CDKL1 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase-like 1 (CDC2-related kinase)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-1201s1c1
Sequence:CCGGCCAAGAGATTTAACTACCATTCTCGAGAATGGTAGTTAAATCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-267s1c1
Sequence:CCGGGCCATCAAGAGGTTTCTGGAACTCGAGTTCCAGAAACCTCTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-525s1c1
Sequence:CCGGTGCCATAAACATAACTGCATACTCGAGTATGCAGTTATGTTTATGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-720s1c1
Sequence:CCGGCCTGTAGATGTCTGGGCAATTCTCGAGAATTGCCCAGACATCTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-1190s1c1
Sequence:CCGGCCACTGTAGTACCAAGAGATTCTCGAGAATCTCTTGGTACTACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183294.2-1495s21c1
Sequence:CCGGCTGCCCACAGCTACAACATTACTCGAGTAATGTTGTAGCTGTGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183294.2-842s21c1
Sequence:CCGGCCCAGGCACCAGCAAGTATTTCTCGAGAAATACTTGCTGGTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183294.2-1015s21c1
Sequence:CCGGGCTGTTGCAGCATCCATATTTCTCGAGAAATATGGATGCTGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183294.2-1247s21c1
Sequence:CCGGGTGATGAAGAATTGATCAATACTCGAGTATTGATCAATTCTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183294
CDKL1 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase-like 1 (CDC2-related kinase)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-1201s1c1
Sequence:CCGGCCAAGAGATTTAACTACCATTCTCGAGAATGGTAGTTAAATCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-267s1c1
Sequence:CCGGGCCATCAAGAGGTTTCTGGAACTCGAGTTCCAGAAACCTCTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-525s1c1
Sequence:CCGGTGCCATAAACATAACTGCATACTCGAGTATGCAGTTATGTTTATGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-720s1c1
Sequence:CCGGCCTGTAGATGTCTGGGCAATTCTCGAGAATTGCCCAGACATCTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-1190s1c1
Sequence:CCGGCCACTGTAGTACCAAGAGATTCTCGAGAATCTCTTGGTACTACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183294.2-1495s21c1
Sequence:CCGGCTGCCCACAGCTACAACATTACTCGAGTAATGTTGTAGCTGTGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183294.2-842s21c1
Sequence:CCGGCCCAGGCACCAGCAAGTATTTCTCGAGAAATACTTGCTGGTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183294.2-1015s21c1
Sequence:CCGGGCTGTTGCAGCATCCATATTTCTCGAGAAATATGGATGCTGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183294.2-1247s21c1
Sequence:CCGGGTGATGAAGAATTGATCAATACTCGAGTATTGATCAATTCTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183294
CDKL1 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase-like 1 (CDC2-related kinase)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-1201s1c1
Sequence:CCGGCCAAGAGATTTAACTACCATTCTCGAGAATGGTAGTTAAATCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-267s1c1
Sequence:CCGGGCCATCAAGAGGTTTCTGGAACTCGAGTTCCAGAAACCTCTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-525s1c1
Sequence:CCGGTGCCATAAACATAACTGCATACTCGAGTATGCAGTTATGTTTATGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-720s1c1
Sequence:CCGGCCTGTAGATGTCTGGGCAATTCTCGAGAATTGCCCAGACATCTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183294.1-1190s1c1
Sequence:CCGGCCACTGTAGTACCAAGAGATTCTCGAGAATCTCTTGGTACTACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183294.2-1495s21c1
Sequence:CCGGCTGCCCACAGCTACAACATTACTCGAGTAATGTTGTAGCTGTGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183294.2-842s21c1
Sequence:CCGGCCCAGGCACCAGCAAGTATTTCTCGAGAAATACTTGCTGGTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183294.2-1015s21c1
Sequence:CCGGGCTGTTGCAGCATCCATATTTCTCGAGAAATATGGATGCTGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183294.2-1247s21c1
Sequence:CCGGGTGATGAAGAATTGATCAATACTCGAGTATTGATCAATTCTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks