EMAIL THIS PAGE TO A FRIEND

CDKL2

cyclin-dependent kinase-like 2 (CDC2-related kinase)

142 Gene Product Result for
Synonyms: KKIAMRE P56
UniProtKB ID: Q92772, B2R695
Gene ID:
Human(8999) Summary: This gene product is a member of a large family of CDC2-related serine/threonine protein kinases. It accumulates primarily in the cytoplasm, with lower levels in the nucleus. [provided by RefSeq, Jul 2008]
Mouse(53886) cyclin-dependent kinase-like 2 (CDC2-related kinase)
Rat(305242) cyclin-dependent kinase-like 2 (CDC2-related kinase)
sheep(101106773) cyclin-dependent kinase-like 2 (CDC2-related kinase)
Domestic Rabbit(100008614) cyclin-dependent kinase-like 2 (CDC2-related kinase)
domestic guinea pig(100734996) cyclin-dependent kinase-like 2 (CDC2-related kinase)
naked mole-rat(101699009) cyclin-dependent kinase-like 2 (CDC2-related kinase)
chicken(428736) cyclin-dependent kinase-like 2 (CDC2-related kinase)
domestic cat(101101561) cyclin-dependent kinase-like 2 (CDC2-related kinase)
cow(533114) cyclin-dependent kinase-like 2 (CDC2-related kinase)
Horse(100050686) cyclin-dependent kinase-like 2 (CDC2-related kinase)
dog(478428) cyclin-dependent kinase-like 2 (CDC2-related kinase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003948 Rosetta Predictions human pricing
NM_001012035 Rosetta Predictions rat pricing
XM_573566 Rosetta Predictions rat pricing
NM_016912 Rosetta Predictions mouse pricing
NM_177270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129338 predicted 1022
2 SASI_Hs02_00336609 predicted 2025
3 SASI_Hs01_00129339 predicted 1132
4 SASI_Hs01_00129341 predicted 1226
5 SASI_Hs02_00336610 predicted 1172
6 SASI_Hs01_00129343 predicted 1224
7 SASI_Hs01_00129344 predicted 1064
8 SASI_Hs01_00129345 predicted 1132
9 SASI_Hs02_00336611 predicted 1768
10 SASI_Hs02_00336612 predicted 1860
11 SASI_Hs01_00129336 predicted 1671
12 SASI_Hs01_00129337 predicted 1566
13 SASI_Hs01_00129340 predicted 915
14 SASI_Hs01_00129342 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050386 predicted 1276
2 SASI_Rn01_00050387 predicted 1541
3 SASI_Rn01_00050388 predicted 725
4 SASI_Rn01_00050389 predicted 1428
5 SASI_Rn01_00050390 predicted 1684
6 SASI_Rn02_00200132 predicted 1113
7 SASI_Rn01_00050391 predicted 1198
8 SASI_Rn01_00050393 predicted 1295
9 SASI_Rn01_00050394 predicted 572
10 SASI_Rn01_00050395 predicted 596
11 SASI_Rn01_00050392 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573566 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160276 predicted 723
2 SASI_Rn01_00160277 predicted 724
3 SASI_Rn01_00160278 predicted 758
4 SASI_Rn01_00160279 predicted 727
5 SASI_Rn01_00160280 predicted 1885
6 SASI_Rn01_00160281 predicted 762
7 SASI_Rn01_00160282 predicted 1120
8 SASI_Rn01_00160283 predicted 1846
9 SASI_Rn01_00160284 predicted 1048
10 SASI_Rn01_00160285 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094512 predicted 1030
2 SASI_Mm01_00094513 predicted 1178
3 SASI_Mm01_00094514 predicted 948
4 SASI_Mm02_00323771 predicted 860
5 SASI_Mm01_00094515 predicted 793
6 SASI_Mm01_00094516 predicted 807
7 SASI_Mm01_00094517 predicted 1590
8 SASI_Mm01_00094518 predicted 1139
9 SASI_Mm01_00094520 predicted 1041
10 SASI_Mm01_00094521 predicted 1387
11 SASI_Mm01_00094519 predicted 1590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070463 predicted 2411
2 SASI_Mm01_00070464 predicted 2117
3 SASI_Mm01_00070465 predicted 2090
4 SASI_Mm01_00070466 predicted 2218
5 SASI_Mm01_00070467 predicted 934
6 SASI_Mm01_00070468 predicted 2144
7 SASI_Mm01_00070469 predicted 851
8 SASI_Mm01_00070470 predicted 783
9 SASI_Mm01_00070471 predicted 791
10 SASI_Mm02_00347317 predicted 2418
11 SASI_Mm01_00070472 predicted 1579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003948
VALIDATED
CDKL2 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase-like 2 (CDC2-related kinase)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003948.3-2313s21c1
Sequence:CCGGTTACTGTTAGGAGATTGTATACTCGAGTATACAATCTCCTAACAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-672s21c1
Sequence:CCGGGCGAGAAATCAAGTTACTAAACTCGAGTTTAGTAACTTGATTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003948.3-2237s21c1
Sequence:CCGGTCACGTCCACCGATGCTATTTCTCGAGAAATAGCATCGGTGGACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-564s21c1
Sequence:CCGGGAGTTATGGAATGGTGATGAACTCGAGTTCATCACCATTCCATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-939s21c1
Sequence:CCGGCGTTGTCAAGCTATGCGATTTCTCGAGAAATCGCATAGCTTGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-1170s21c1
Sequence:CCGGGATGTGTTTAGGTAATCTAATCTCGAGATTAGATTACCTAAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-989s21c1
Sequence:CCGGGGGAGGTTTATACTGATTATGCTCGAGCATAATCAGTATAAACCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003948.x-1874s1c1
Sequence:CCGGGAACTGGATGATGCTCTTGCACTCGAGTGCAAGAGCATCATCCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003948.x-414s1c1
Sequence:CCGGGAGTTATGGAATGGTGATGAACTCGAGTTCATCACCATTCCATAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003948.x-1515s1c1
Sequence:CCGGCAGTAGGACAAGCCACAACAACTCGAGTTGTTGTGGCTTGTCCTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003948.x-521s1c1
Sequence:CCGGTGCGAGAAATCAAGTTACTAACTCGAGTTAGTAACTTGATTTCTCGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003948.x-1756s1c1
Sequence:CCGGCCATCAGGCATTTATAACATTCTCGAGAATGTTATAAATGCCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003948.2-935s1c1
Sequence:CCGGCCATTGGTTGTCTGGTAACTGCTCGAGCAGTTACCAGACAACCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003948.2-992s1c1
Sequence:CCGGCTGATATTGATCAGCTATATCCTCGAGGATATAGCTGATCAATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003948
VALIDATED
CDKL2 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase-like 2 (CDC2-related kinase)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003948.3-2313s21c1
Sequence:CCGGTTACTGTTAGGAGATTGTATACTCGAGTATACAATCTCCTAACAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-672s21c1
Sequence:CCGGGCGAGAAATCAAGTTACTAAACTCGAGTTTAGTAACTTGATTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003948.3-2237s21c1
Sequence:CCGGTCACGTCCACCGATGCTATTTCTCGAGAAATAGCATCGGTGGACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-564s21c1
Sequence:CCGGGAGTTATGGAATGGTGATGAACTCGAGTTCATCACCATTCCATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-939s21c1
Sequence:CCGGCGTTGTCAAGCTATGCGATTTCTCGAGAAATCGCATAGCTTGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-1170s21c1
Sequence:CCGGGATGTGTTTAGGTAATCTAATCTCGAGATTAGATTACCTAAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-989s21c1
Sequence:CCGGGGGAGGTTTATACTGATTATGCTCGAGCATAATCAGTATAAACCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003948.x-1874s1c1
Sequence:CCGGGAACTGGATGATGCTCTTGCACTCGAGTGCAAGAGCATCATCCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003948.x-414s1c1
Sequence:CCGGGAGTTATGGAATGGTGATGAACTCGAGTTCATCACCATTCCATAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003948.x-1515s1c1
Sequence:CCGGCAGTAGGACAAGCCACAACAACTCGAGTTGTTGTGGCTTGTCCTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003948.x-521s1c1
Sequence:CCGGTGCGAGAAATCAAGTTACTAACTCGAGTTAGTAACTTGATTTCTCGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003948.x-1756s1c1
Sequence:CCGGCCATCAGGCATTTATAACATTCTCGAGAATGTTATAAATGCCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003948.2-935s1c1
Sequence:CCGGCCATTGGTTGTCTGGTAACTGCTCGAGCAGTTACCAGACAACCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003948.2-992s1c1
Sequence:CCGGCTGATATTGATCAGCTATATCCTCGAGGATATAGCTGATCAATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003948
VALIDATED
CDKL2 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase-like 2 (CDC2-related kinase)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003948.3-2313s21c1
Sequence:CCGGTTACTGTTAGGAGATTGTATACTCGAGTATACAATCTCCTAACAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-672s21c1
Sequence:CCGGGCGAGAAATCAAGTTACTAAACTCGAGTTTAGTAACTTGATTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003948.3-2237s21c1
Sequence:CCGGTCACGTCCACCGATGCTATTTCTCGAGAAATAGCATCGGTGGACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-564s21c1
Sequence:CCGGGAGTTATGGAATGGTGATGAACTCGAGTTCATCACCATTCCATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-939s21c1
Sequence:CCGGCGTTGTCAAGCTATGCGATTTCTCGAGAAATCGCATAGCTTGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-1170s21c1
Sequence:CCGGGATGTGTTTAGGTAATCTAATCTCGAGATTAGATTACCTAAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003948.3-989s21c1
Sequence:CCGGGGGAGGTTTATACTGATTATGCTCGAGCATAATCAGTATAAACCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003948.x-1874s1c1
Sequence:CCGGGAACTGGATGATGCTCTTGCACTCGAGTGCAAGAGCATCATCCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003948.x-414s1c1
Sequence:CCGGGAGTTATGGAATGGTGATGAACTCGAGTTCATCACCATTCCATAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003948.x-1515s1c1
Sequence:CCGGCAGTAGGACAAGCCACAACAACTCGAGTTGTTGTGGCTTGTCCTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003948.x-521s1c1
Sequence:CCGGTGCGAGAAATCAAGTTACTAACTCGAGTTAGTAACTTGATTTCTCGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003948.x-1756s1c1
Sequence:CCGGCCATCAGGCATTTATAACATTCTCGAGAATGTTATAAATGCCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003948.2-935s1c1
Sequence:CCGGCCATTGGTTGTCTGGTAACTGCTCGAGCAGTTACCAGACAACCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003948.2-992s1c1
Sequence:CCGGCTGATATTGATCAGCTATATCCTCGAGGATATAGCTGATCAATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016912
VALIDATED
CDKL2 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase-like 2 (CDC2-related kinase)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016912.1-1774s21c1
Sequence:CCGGTAGAAGGCATAGCTCGAAATTCTCGAGAATTTCGAGCTATGCCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016912.1-356s21c1
Sequence:CCGGCCTAGAAAGTGACGATGATAACTCGAGTTATCATCGTCACTTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016912.1-874s21c1
Sequence:CCGGTTGATCAGCTACATCATATTACTCGAGTAATATGATGTAGCTGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016912.1-1785s1c1
Sequence:CCGGGCTCGAAATTCTAGGCTAATACTCGAGTATTAGCCTAGAATTTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016912.1-1180s1c1
Sequence:CCGGCCAGGAATAATTCTTTACCTACTCGAGTAGGTAAAGAATTATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016912.1-1734s1c1
Sequence:CCGGCCTGAACTAAACTATAACCATCTCGAGATGGTTATAGTTTAGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016912.1-342s1c1
Sequence:CCGGGCCATTAAGAAGTTCCTAGAACTCGAGTTCTAGGAACTTCTTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016912
VALIDATED
CDKL2 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase-like 2 (CDC2-related kinase)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016912.1-1774s21c1
Sequence:CCGGTAGAAGGCATAGCTCGAAATTCTCGAGAATTTCGAGCTATGCCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016912.1-356s21c1
Sequence:CCGGCCTAGAAAGTGACGATGATAACTCGAGTTATCATCGTCACTTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016912.1-874s21c1
Sequence:CCGGTTGATCAGCTACATCATATTACTCGAGTAATATGATGTAGCTGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016912.1-1785s1c1
Sequence:CCGGGCTCGAAATTCTAGGCTAATACTCGAGTATTAGCCTAGAATTTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016912.1-1180s1c1
Sequence:CCGGCCAGGAATAATTCTTTACCTACTCGAGTAGGTAAAGAATTATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016912.1-1734s1c1
Sequence:CCGGCCTGAACTAAACTATAACCATCTCGAGATGGTTATAGTTTAGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016912.1-342s1c1
Sequence:CCGGGCCATTAAGAAGTTCCTAGAACTCGAGTTCTAGGAACTTCTTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016912
VALIDATED
CDKL2 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase-like 2 (CDC2-related kinase)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016912.1-1774s21c1
Sequence:CCGGTAGAAGGCATAGCTCGAAATTCTCGAGAATTTCGAGCTATGCCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016912.1-356s21c1
Sequence:CCGGCCTAGAAAGTGACGATGATAACTCGAGTTATCATCGTCACTTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016912.1-874s21c1
Sequence:CCGGTTGATCAGCTACATCATATTACTCGAGTAATATGATGTAGCTGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016912.1-1785s1c1
Sequence:CCGGGCTCGAAATTCTAGGCTAATACTCGAGTATTAGCCTAGAATTTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016912.1-1180s1c1
Sequence:CCGGCCAGGAATAATTCTTTACCTACTCGAGTAGGTAAAGAATTATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016912.1-1734s1c1
Sequence:CCGGCCTGAACTAAACTATAACCATCTCGAGATGGTTATAGTTTAGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016912.1-342s1c1
Sequence:CCGGGCCATTAAGAAGTTCCTAGAACTCGAGTTCTAGGAACTTCTTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks