EMAIL THIS PAGE TO A FRIEND

CDKL3

cyclin-dependent kinase-like 3

104 Gene Product Result for
Synonyms: NKIAMRE
UniProtKB ID: Q8IVW4, D3DQA0, D3DQA1, Q9P114
Gene ID:
Human(51265) Summary: The protein encoded by this gene is a member of cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This gene was identified as a gene absent in leukemic patients with chromosome 5q deletion. This loss may be an important determinant of dysmyelopoiesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(213084) cyclin-dependent kinase-like 3
Rat(60396) cyclin-dependent kinase-like 3
cow(541279) cyclin-dependent kinase-like 3
Horse(100072771) cyclin-dependent kinase-like 3
domestic cat(101086198) cyclin-dependent kinase-like 3
dog(608339) cyclin-dependent kinase-like 3
naked mole-rat(101704258) cyclin-dependent kinase-like 3
domestic guinea pig(100713068) cyclin-dependent kinase-like 3
sheep(101102479) cyclin-dependent kinase-like 3
Domestic Rabbit(100339713) cyclin-dependent kinase-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016508 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056161 MISSION® esiRNA esiRNA human CDKL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113575 Rosetta Predictions human pricing
NM_016508 Rosetta Predictions human pricing
NM_021772 Rosetta Predictions rat pricing
NM_153785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326101 predicted 779
2 SASI_Hs02_00326102 predicted 519
3 SASI_Hs02_00326103 predicted 1243
4 SASI_Hs02_00326104 predicted 610
5 SASI_Hs02_00326105 predicted 443
6 SASI_Hs02_00326106 predicted 1078
7 SASI_Hs02_00326107 predicted 708
8 SASI_Hs02_00326108 predicted 231
9 SASI_Hs02_00326109 predicted 932
10 SASI_Hs02_00326110 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215728 predicted 774
2 SASI_Hs01_00215729 predicted 528
3 SASI_Hs01_00215731 predicted 1237
4 SASI_Hs01_00215732 predicted 601
5 SASI_Hs01_00215733 predicted 451
6 SASI_Hs02_00349584 predicted 1084
7 SASI_Hs01_00215735 predicted 709
8 SASI_Hs02_00349585 predicted 227
9 SASI_Hs01_00215736 predicted 930
10 SASI_Hs02_00349586 predicted 656
11 SASI_Hs01_00215727 predicted 1007
12 SASI_Hs01_00215730 predicted 1127
13 SASI_Hs01_00215734 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049014 predicted 279
2 SASI_Rn01_00049015 predicted 725
3 SASI_Rn01_00049016 predicted 209
4 SASI_Rn01_00049017 predicted 1016
5 SASI_Rn01_00049018 predicted 215
6 SASI_Rn01_00049019 predicted 1137
7 SASI_Rn01_00049020 predicted 1426
8 SASI_Rn01_00049021 predicted 979
9 SASI_Rn01_00049022 predicted 424
10 SASI_Rn01_00049023 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343508 predicted 1114
2 SASI_Mm01_00071593 predicted 504
3 SASI_Mm01_00071594 predicted 798
4 SASI_Mm01_00071595 predicted 1055
5 SASI_Mm01_00071596 predicted 1501
6 SASI_Mm01_00071597 predicted 530
7 SASI_Mm01_00071598 predicted 1049
8 SASI_Mm01_00071599 predicted 1206
9 SASI_Mm01_00071600 predicted 981
10 SASI_Mm01_00071602 predicted 1605
11 SASI_Mm01_00071601 predicted 1570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016508
VALIDATED
CDKL3 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase-like 3
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-1324s1c1
Sequence:CCGGGCTGCAAATCTCAGTTCAAATCTCGAGATTTGAACTGAGATTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-819s1c1
Sequence:CCGGCAGGATATCATCTAGTGATCTCTCGAGAGATCACTAGATGATATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-557s1c1
Sequence:CCGGCTTTGGGCTGTATGATCATTGCTCGAGCAATGATCATACAGCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-115s1c1
Sequence:CCGGCCAGAACAATCTGTCAACAAACTCGAGTTTGTTGACAGATTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-1063s1c1
Sequence:CCGGGAGATCAAAGTCAGAGTTATTCTCGAGAATAACTCTGACTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.x-250s1c1
Sequence:CCGGCACACAGTATTAGATGAGTTACTCGAGTAACTCATCTAATACTGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016508.x-1442s1c1
Sequence:CCGGGTCTGTATGTAAACTGAACTTCTCGAGAAGTTCAGTTTACATACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.x-1237s1c1
Sequence:CCGGACTAACTGTAATGGCTTGAAACTCGAGTTTCAAGCCATTACAGTTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.x-1295s1c1
Sequence:CCGGCCATCAATCTAACTAACAGTACTCGAGTACTGTTAGTTAGATTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.x-1290s1c1
Sequence:CCGGGCCACCCATCAATCTAACTAACTCGAGTTAGTTAGATTGATGGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_016508.3-1410s21c1
Sequence:CCGGCCACCCATCAATCTAACTAACCTCGAGGTTAGTTAGATTGATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016508.3-160s21c1
Sequence:CCGGGTTACGGAACAGTCATGAAATCTCGAGATTTCATGACTGTTCCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016508.3-612s21c1
Sequence:CCGGTGGTATAGAGCTCCCGAATTACTCGAGTAATTCGGGAGCTCTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016508.3-735s21c1
Sequence:CCGGGATTTGGATTTACTCCATAAACTCGAGTTTATGGAGTAAATCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016508.3-886s21c1
Sequence:CCGGATGGATTGTTGGCAGATATAGCTCGAGCTATATCTGCCAACAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016508.3-204s21c1
Sequence:CCGGATAGTGGCCATTAAGATATTTCTCGAGAAATATCTTAATGGCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016508.3-458s21c1
Sequence:CCGGTGACTATCTTCACAGTAATAACTCGAGTTATTACTGTGAAGATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_016508.3-407s21c1
Sequence:CCGGACTAGAGAGTAAGCGACTTAGCTCGAGCTAAGTCGCTTACTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016508
VALIDATED
CDKL3 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase-like 3
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-1324s1c1
Sequence:CCGGGCTGCAAATCTCAGTTCAAATCTCGAGATTTGAACTGAGATTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-819s1c1
Sequence:CCGGCAGGATATCATCTAGTGATCTCTCGAGAGATCACTAGATGATATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-557s1c1
Sequence:CCGGCTTTGGGCTGTATGATCATTGCTCGAGCAATGATCATACAGCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-115s1c1
Sequence:CCGGCCAGAACAATCTGTCAACAAACTCGAGTTTGTTGACAGATTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-1063s1c1
Sequence:CCGGGAGATCAAAGTCAGAGTTATTCTCGAGAATAACTCTGACTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.x-250s1c1
Sequence:CCGGCACACAGTATTAGATGAGTTACTCGAGTAACTCATCTAATACTGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016508.x-1442s1c1
Sequence:CCGGGTCTGTATGTAAACTGAACTTCTCGAGAAGTTCAGTTTACATACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.x-1237s1c1
Sequence:CCGGACTAACTGTAATGGCTTGAAACTCGAGTTTCAAGCCATTACAGTTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.x-1295s1c1
Sequence:CCGGCCATCAATCTAACTAACAGTACTCGAGTACTGTTAGTTAGATTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.x-1290s1c1
Sequence:CCGGGCCACCCATCAATCTAACTAACTCGAGTTAGTTAGATTGATGGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_016508.3-1410s21c1
Sequence:CCGGCCACCCATCAATCTAACTAACCTCGAGGTTAGTTAGATTGATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016508.3-160s21c1
Sequence:CCGGGTTACGGAACAGTCATGAAATCTCGAGATTTCATGACTGTTCCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016508.3-612s21c1
Sequence:CCGGTGGTATAGAGCTCCCGAATTACTCGAGTAATTCGGGAGCTCTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016508.3-735s21c1
Sequence:CCGGGATTTGGATTTACTCCATAAACTCGAGTTTATGGAGTAAATCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016508.3-886s21c1
Sequence:CCGGATGGATTGTTGGCAGATATAGCTCGAGCTATATCTGCCAACAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016508.3-204s21c1
Sequence:CCGGATAGTGGCCATTAAGATATTTCTCGAGAAATATCTTAATGGCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016508.3-458s21c1
Sequence:CCGGTGACTATCTTCACAGTAATAACTCGAGTTATTACTGTGAAGATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_016508.3-407s21c1
Sequence:CCGGACTAGAGAGTAAGCGACTTAGCTCGAGCTAAGTCGCTTACTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016508
VALIDATED
CDKL3 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase-like 3
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-1324s1c1
Sequence:CCGGGCTGCAAATCTCAGTTCAAATCTCGAGATTTGAACTGAGATTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-819s1c1
Sequence:CCGGCAGGATATCATCTAGTGATCTCTCGAGAGATCACTAGATGATATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-557s1c1
Sequence:CCGGCTTTGGGCTGTATGATCATTGCTCGAGCAATGATCATACAGCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-115s1c1
Sequence:CCGGCCAGAACAATCTGTCAACAAACTCGAGTTTGTTGACAGATTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.2-1063s1c1
Sequence:CCGGGAGATCAAAGTCAGAGTTATTCTCGAGAATAACTCTGACTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.x-250s1c1
Sequence:CCGGCACACAGTATTAGATGAGTTACTCGAGTAACTCATCTAATACTGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016508.x-1442s1c1
Sequence:CCGGGTCTGTATGTAAACTGAACTTCTCGAGAAGTTCAGTTTACATACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.x-1237s1c1
Sequence:CCGGACTAACTGTAATGGCTTGAAACTCGAGTTTCAAGCCATTACAGTTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.x-1295s1c1
Sequence:CCGGCCATCAATCTAACTAACAGTACTCGAGTACTGTTAGTTAGATTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016508.x-1290s1c1
Sequence:CCGGGCCACCCATCAATCTAACTAACTCGAGTTAGTTAGATTGATGGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_016508.3-1410s21c1
Sequence:CCGGCCACCCATCAATCTAACTAACCTCGAGGTTAGTTAGATTGATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016508.3-160s21c1
Sequence:CCGGGTTACGGAACAGTCATGAAATCTCGAGATTTCATGACTGTTCCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016508.3-612s21c1
Sequence:CCGGTGGTATAGAGCTCCCGAATTACTCGAGTAATTCGGGAGCTCTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016508.3-735s21c1
Sequence:CCGGGATTTGGATTTACTCCATAAACTCGAGTTTATGGAGTAAATCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016508.3-886s21c1
Sequence:CCGGATGGATTGTTGGCAGATATAGCTCGAGCTATATCTGCCAACAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016508.3-204s21c1
Sequence:CCGGATAGTGGCCATTAAGATATTTCTCGAGAAATATCTTAATGGCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016508.3-458s21c1
Sequence:CCGGTGACTATCTTCACAGTAATAACTCGAGTTATTACTGTGAAGATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_016508.3-407s21c1
Sequence:CCGGACTAGAGAGTAAGCGACTTAGCTCGAGCTAAGTCGCTTACTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153785
VALIDATED
CDKL3 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase-like 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153785.1-510s1c1
Sequence:CCGGCGCCATTGAGTACCTGCATAACTCGAGTTATGCAGGTACTCAATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153785.1-841s1c1
Sequence:CCGGCCGCACCTGCACAATATCTTTCTCGAGAAAGATATTGTGCAGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153785.1-777s1c1
Sequence:CCGGCCTTCCTAGCAGTTCCGATTTCTCGAGAAATCGGAACTGCTAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153785.1-316s1c1
Sequence:CCGGGCAACGAGAGAAATAAAGTTTCTCGAGAAACTTTATTTCTCTCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153785.1-227s1c1
Sequence:CCGGCGGTCATGAAATGCAAACATACTCGAGTATGTTTGCATTTCATGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153785.3-804s21c1
Sequence:CCGGCCTTCCTAGCAGTTCCGATTTCTCGAGAAATCGGAACTGCTAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153785.3-254s21c1
Sequence:CCGGCGGTCATGAAATGCAAACATACTCGAGTATGTTTGCATTTCATGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153785.3-343s21c1
Sequence:CCGGGCAACGAGAGAAATAAAGTTTCTCGAGAAACTTTATTTCTCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153785.3-2473s21c1
Sequence:CCGGATATGATGTTCCTAGGTTAAACTCGAGTTTAACCTAGGAACATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153785
VALIDATED
CDKL3 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase-like 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153785.1-510s1c1
Sequence:CCGGCGCCATTGAGTACCTGCATAACTCGAGTTATGCAGGTACTCAATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153785.1-841s1c1
Sequence:CCGGCCGCACCTGCACAATATCTTTCTCGAGAAAGATATTGTGCAGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153785.1-777s1c1
Sequence:CCGGCCTTCCTAGCAGTTCCGATTTCTCGAGAAATCGGAACTGCTAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153785.1-316s1c1
Sequence:CCGGGCAACGAGAGAAATAAAGTTTCTCGAGAAACTTTATTTCTCTCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153785.1-227s1c1
Sequence:CCGGCGGTCATGAAATGCAAACATACTCGAGTATGTTTGCATTTCATGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153785.3-804s21c1
Sequence:CCGGCCTTCCTAGCAGTTCCGATTTCTCGAGAAATCGGAACTGCTAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153785.3-254s21c1
Sequence:CCGGCGGTCATGAAATGCAAACATACTCGAGTATGTTTGCATTTCATGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153785.3-343s21c1
Sequence:CCGGGCAACGAGAGAAATAAAGTTTCTCGAGAAACTTTATTTCTCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153785.3-2473s21c1
Sequence:CCGGATATGATGTTCCTAGGTTAAACTCGAGTTTAACCTAGGAACATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153785
VALIDATED
CDKL3 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase-like 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153785.1-510s1c1
Sequence:CCGGCGCCATTGAGTACCTGCATAACTCGAGTTATGCAGGTACTCAATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153785.1-841s1c1
Sequence:CCGGCCGCACCTGCACAATATCTTTCTCGAGAAAGATATTGTGCAGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153785.1-777s1c1
Sequence:CCGGCCTTCCTAGCAGTTCCGATTTCTCGAGAAATCGGAACTGCTAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153785.1-316s1c1
Sequence:CCGGGCAACGAGAGAAATAAAGTTTCTCGAGAAACTTTATTTCTCTCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153785.1-227s1c1
Sequence:CCGGCGGTCATGAAATGCAAACATACTCGAGTATGTTTGCATTTCATGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153785.3-804s21c1
Sequence:CCGGCCTTCCTAGCAGTTCCGATTTCTCGAGAAATCGGAACTGCTAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153785.3-254s21c1
Sequence:CCGGCGGTCATGAAATGCAAACATACTCGAGTATGTTTGCATTTCATGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153785.3-343s21c1
Sequence:CCGGGCAACGAGAGAAATAAAGTTTCTCGAGAAACTTTATTTCTCTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153785.3-2473s21c1
Sequence:CCGGATATGATGTTCCTAGGTTAAACTCGAGTTTAACCTAGGAACATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks