EMAIL THIS PAGE TO A FRIEND

CDKL4

cyclin-dependent kinase-like 4

92 Gene Product Result for
UniProtKB ID: Q5MAI5
Gene ID:
Mouse(381113) cyclin-dependent kinase-like 4
Rat(503009) cyclin-dependent kinase-like 4
sheep(101117576) cyclin-dependent kinase-like 4
domestic guinea pig(100715898) cyclin-dependent kinase-like 4
naked mole-rat(101708485) cyclin-dependent kinase-like 4
dog(608890) cyclin-dependent kinase-like 4
domestic cat(101095572) cyclin-dependent kinase-like 4
cow(517478) cyclin-dependent kinase-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001009565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009565 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_293029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_293029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_293029 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009565 Rosetta Predictions human pricing
XM_001062504 Rosetta Predictions rat pricing
XM_578522 Rosetta Predictions rat pricing
NM_001033443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187017 predicted 815
2 SASI_Hs01_00187018 predicted 798
3 SASI_Hs01_00187019 predicted 361
4 SASI_Hs02_00305634 predicted 394
5 SASI_Hs01_00187020 predicted 615
6 SASI_Hs01_00187021 predicted 316
7 SASI_Hs01_00187022 predicted 406
8 SASI_Hs01_00187023 predicted 605
9 SASI_Hs01_00187024 predicted 502
10 SASI_Hs01_00187026 predicted 360
11 SASI_Hs01_00187025 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303688 predicted 421
2 SASI_Rn02_00303689 predicted 606
3 SASI_Rn02_00303690 predicted 428
4 SASI_Rn02_00303691 predicted 282
5 SASI_Rn02_00303692 predicted 401
6 SASI_Rn02_00303693 predicted 363
7 SASI_Rn02_00303694 predicted 399
8 SASI_Rn02_00303695 predicted 766
9 SASI_Rn02_00303696 predicted 406
10 SASI_Rn02_00303697 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408077 predicted 1126
2 SASI_Rn02_00408078 predicted 952
3 SASI_Rn02_00408079 predicted 804
4 SASI_Rn02_00408080 predicted 587
5 SASI_Rn02_00408081 predicted 878
6 SASI_Rn02_00408082 predicted 429
7 SASI_Rn02_00408083 predicted 551
8 SASI_Rn02_00408084 predicted 1312
9 SASI_Rn02_00408085 predicted 437
10 SASI_Rn02_00408086 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163015 predicted 572
2 SASI_Mm01_00163016 predicted 839
3 SASI_Mm02_00288765 predicted 685
4 SASI_Mm01_00163018 predicted 451
5 SASI_Mm01_00163019 predicted 791
6 SASI_Mm01_00163021 predicted 514
7 SASI_Mm01_00163020 predicted 1174
8 SASI_Mm01_00163022 predicted 526
9 SASI_Mm01_00163023 predicted 243
10 SASI_Mm02_00288766 predicted 409
11 SASI_Mm01_00163017 predicted 417
12 SASI_Mm01_00163024 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033443
CDKL4 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase-like 4
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000368030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033443.4-530s21c1
Sequence:CCGGTTGTATTCATCGGGATGTAAACTCGAGTTTACATCCCGATGAATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033443.4-1174s21c1
Sequence:CCGGTCGATCATCTTCCAAACATTTCTCGAGAAATGTTTGGAAGATGATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033443
CDKL4 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase-like 4
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000368030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033443.4-530s21c1
Sequence:CCGGTTGTATTCATCGGGATGTAAACTCGAGTTTACATCCCGATGAATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033443.4-1174s21c1
Sequence:CCGGTCGATCATCTTCCAAACATTTCTCGAGAAATGTTTGGAAGATGATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033443
CDKL4 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase-like 4
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000368030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033443.4-530s21c1
Sequence:CCGGTTGTATTCATCGGGATGTAAACTCGAGTTTACATCCCGATGAATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033443.4-1174s21c1
Sequence:CCGGTCGATCATCTTCCAAACATTTCTCGAGAAATGTTTGGAAGATGATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009565
CDKL4 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase-like 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009565.1-1197s21c1
Sequence:CCGGACAAGATCGTATACCCATAATCTCGAGATTATGGGTATACGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009565.1-533s21c1
Sequence:CCGGATGGTTCTTCAGTCGATATATCTCGAGATATATCGACTGAAGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009565.1-461s21c1
Sequence:CCGGGAGATGCCTACACCGATTATGCTCGAGCATAATCGGTGTAGGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009565.1-156s21c1
Sequence:CCGGACGTATGTTGAAGCAATTAAACTCGAGTTTAATTGCTTCAACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009565.1-846s1c1
Sequence:CCGGGAGCTCCTACTTTGATTCTTTCTCGAGAAAGAATCAAAGTAGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009565.1-181s1c1
Sequence:CCGGCCAAATCTTGTGAACCTCATCCTCGAGGATGAGGTTCACAAGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009565.1-1198s1c1
Sequence:CCGGCAAGATCGTATACCCATAATACTCGAGTATTATGGGTATACGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009565
CDKL4 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase-like 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009565.1-1197s21c1
Sequence:CCGGACAAGATCGTATACCCATAATCTCGAGATTATGGGTATACGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009565.1-533s21c1
Sequence:CCGGATGGTTCTTCAGTCGATATATCTCGAGATATATCGACTGAAGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009565.1-461s21c1
Sequence:CCGGGAGATGCCTACACCGATTATGCTCGAGCATAATCGGTGTAGGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009565.1-156s21c1
Sequence:CCGGACGTATGTTGAAGCAATTAAACTCGAGTTTAATTGCTTCAACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009565.1-846s1c1
Sequence:CCGGGAGCTCCTACTTTGATTCTTTCTCGAGAAAGAATCAAAGTAGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009565.1-181s1c1
Sequence:CCGGCCAAATCTTGTGAACCTCATCCTCGAGGATGAGGTTCACAAGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009565.1-1198s1c1
Sequence:CCGGCAAGATCGTATACCCATAATACTCGAGTATTATGGGTATACGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009565
CDKL4 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase-like 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009565.1-1197s21c1
Sequence:CCGGACAAGATCGTATACCCATAATCTCGAGATTATGGGTATACGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009565.1-533s21c1
Sequence:CCGGATGGTTCTTCAGTCGATATATCTCGAGATATATCGACTGAAGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009565.1-461s21c1
Sequence:CCGGGAGATGCCTACACCGATTATGCTCGAGCATAATCGGTGTAGGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009565.1-156s21c1
Sequence:CCGGACGTATGTTGAAGCAATTAAACTCGAGTTTAATTGCTTCAACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009565.1-846s1c1
Sequence:CCGGGAGCTCCTACTTTGATTCTTTCTCGAGAAAGAATCAAAGTAGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009565.1-181s1c1
Sequence:CCGGCCAAATCTTGTGAACCTCATCCTCGAGGATGAGGTTCACAAGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001009565.1-1198s1c1
Sequence:CCGGCAAGATCGTATACCCATAATACTCGAGTATTATGGGTATACGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355031
CDKL4 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase-like 4
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000023274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355031.1-215s1c1
Sequence:CCGGCGTTGTATTCAAGTGCAGAAACTCGAGTTTCTGCACTTGAATACAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355031.1-280s1c1
Sequence:CCGGCTGAAGATGATCGTGTCGTTACTCGAGTAACGACACGATCATCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355031.1-324s1c1
Sequence:CCGGCGTATGCTGAAGCAGTTGAAACTCGAGTTTCAACTGCTTCAGCATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355031
CDKL4 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase-like 4
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000023274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355031.1-215s1c1
Sequence:CCGGCGTTGTATTCAAGTGCAGAAACTCGAGTTTCTGCACTTGAATACAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355031.1-280s1c1
Sequence:CCGGCTGAAGATGATCGTGTCGTTACTCGAGTAACGACACGATCATCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355031.1-324s1c1
Sequence:CCGGCGTATGCTGAAGCAGTTGAAACTCGAGTTTCAACTGCTTCAGCATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355031
CDKL4 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase-like 4
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000023274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355031.1-215s1c1
Sequence:CCGGCGTTGTATTCAAGTGCAGAAACTCGAGTTTCTGCACTTGAATACAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355031.1-280s1c1
Sequence:CCGGCTGAAGATGATCGTGTCGTTACTCGAGTAACGACACGATCATCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355031.1-324s1c1
Sequence:CCGGCGTATGCTGAAGCAGTTGAAACTCGAGTTTCAACTGCTTCAGCATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_293029
CDKL4 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase-like 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000021523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293029.3-549s1c1
Sequence:CCGGGTATGGTTCTTCAGTCGATATCTCGAGATATCGACTGAAGAACCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293029.3-113s1c1
Sequence:CCGGCTGAAGATGATCCTGTTGTTACTCGAGTAACAACAGGATCATCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293029.3-491s1c1
Sequence:CCGGCCGATTATGTAGCTACGAGATCTCGAGATCTCGTAGCTACATAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293029.3-682s1c1
Sequence:CCGGCCAAGACATCAATCAATCTTTCTCGAGAAAGATTGATTGATGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_293029
CDKL4 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase-like 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000021523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293029.3-549s1c1
Sequence:CCGGGTATGGTTCTTCAGTCGATATCTCGAGATATCGACTGAAGAACCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293029.3-113s1c1
Sequence:CCGGCTGAAGATGATCCTGTTGTTACTCGAGTAACAACAGGATCATCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293029.3-491s1c1
Sequence:CCGGCCGATTATGTAGCTACGAGATCTCGAGATCTCGTAGCTACATAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293029.3-682s1c1
Sequence:CCGGCCAAGACATCAATCAATCTTTCTCGAGAAAGATTGATTGATGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_293029
CDKL4 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase-like 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000021523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293029.3-549s1c1
Sequence:CCGGGTATGGTTCTTCAGTCGATATCTCGAGATATCGACTGAAGAACCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293029.3-113s1c1
Sequence:CCGGCTGAAGATGATCCTGTTGTTACTCGAGTAACAACAGGATCATCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293029.3-491s1c1
Sequence:CCGGCCGATTATGTAGCTACGAGATCTCGAGATCTCGTAGCTACATAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293029.3-682s1c1
Sequence:CCGGCCAAGACATCAATCAATCTTTCTCGAGAAAGATTGATTGATGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks