EMAIL THIS PAGE TO A FRIEND

CDKL5

cyclin-dependent kinase-like 5

Synonyms: EIEE2 ISSX STK9
UniProtKB ID: O76039, G9B9X4, Q14198, Q5H985, Q8IYC7, Q9UJL6
Gene ID:
Human(6792) Summary: This gene is a member of Ser/Thr protein kinase family and encodes a phosphorylated protein with protein kinase activity. Mutations in this gene have been associated with X-linked infantile spasm syndrome (ISSX), also known as X-linked West syndrome, and Rett syndrome (RTT). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
Mouse(382253) cyclin-dependent kinase-like 5
Rat(100362725) cyclin-dependent kinase-like 5
Zebrafish(559341) cyclin-dependent kinase-like 5
chicken(428001) cyclin-dependent kinase-like 5
cow(538337) cyclin-dependent kinase-like 5
Horse(100057902) cyclin-dependent kinase-like 5
domestic cat(101099939) cyclin-dependent kinase-like 5
dog(491761) cyclin-dependent kinase-like 5
naked mole-rat(101712589) cyclin-dependent kinase-like 5
domestic guinea pig(100719029) cyclin-dependent kinase-like 5
sheep(101108546) cyclin-dependent kinase-like 5
Domestic Rabbit(100355402) cyclin-dependent kinase-like 5
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003159 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_356367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_356367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_356367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037343 Rosetta Predictions human pricing
NM_003159 siRNAs that have been validated in the lab human pricing
NM_001024624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246971 predicted 2440
2 SASI_Hs01_00246972 predicted 348
3 SASI_Hs02_00308290 predicted 735
4 SASI_Hs01_00246973 predicted 333
5 SASI_Hs01_00246974 predicted 1796
6 SASI_Hs01_00246975 predicted 1140
7 SASI_Hs01_00246976 predicted 309
8 SASI_Hs01_00246978 predicted 585
9 SASI_Hs01_00246980 predicted 3004
10 SASI_Hs02_00308291 predicted 2662
11 SASI_Hs01_00246977 predicted 565
12 SASI_Hs01_00246979 predicted 2547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003159 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037689 validated 2440
1 SASI_Hs01_00037694 validated 319
2 SASI_Hs01_00037690 predicted 350
3 SASI_Hs02_00335166 predicted 730
4 SASI_Hs01_00037691 predicted 344
5 SASI_Hs01_00037692 predicted 1798
6 SASI_Hs01_00037693 predicted 1150
7 SASI_Hs01_00037696 predicted 586
8 SASI_Hs01_00037698 predicted 3006
9 SASI_Hs02_00335167 predicted 2667
10 SASI_Hs01_00037695 predicted 562
11 SASI_Hs01_00037697 predicted 2547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287637 predicted 1501
2 SASI_Mm02_00287638 predicted 725
3 SASI_Mm02_00287639 predicted 596
4 SASI_Mm02_00287640 predicted 317
5 SASI_Mm02_00287641 predicted 1783
6 SASI_Mm02_00287642 predicted 894
7 SASI_Mm02_00287643 predicted 2979
8 SASI_Mm02_00287644 predicted 1775
9 SASI_Mm02_00287645 predicted 1073
10 SASI_Mm02_00287646 predicted 1633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003159
CDKL5 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase-like 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003159.2-320s1c1
Sequence:CCGGGCCTATGGAGTTGTACTTAAACTCGAGTTTAAGTACAACTCCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003159.2-682s1c1
Sequence:CCGGCAGCCACAATGATGTCCTAAACTCGAGTTTAGGACATCATTGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003159.2-359s1c1
Sequence:CCGGCATGAAATTGTGGCGATCAAGCTCGAGCTTGATCGCCACAATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003159.x-2750s1c1
Sequence:CCGGACATCTCTCTTCGGCCTCAAACTCGAGTTTGAGGCCGAAGAGAGATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003159.x-438s1c1
Sequence:CCGGGTGGAGTTGAAGGAAGCATTTCTCGAGAAATGCTTCCTTCAACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003159.x-563s1c1
Sequence:CCGGCTACATCTATCAGCTAATCAACTCGAGTTGATTAGCTGATAGATGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003159.x-3004s1c1
Sequence:CCGGCGACAGAACAACAAGGAGAATCTCGAGATTCTCCTTGTTGTTCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003159.2-321s21c1
Sequence:CCGGCCTATGGAGTTGTACTTAAATCTCGAGATTTAAGTACAACTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003159.2-641s21c1
Sequence:CCGGGATATTGTCCATCGAGATATACTCGAGTATATCTCGATGGACAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003159.2-1643s21c1
Sequence:CCGGCAGAGTCGGCATAGCTATATTCTCGAGAATATAGCTATGCCGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003159
CDKL5 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase-like 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003159.2-320s1c1
Sequence:CCGGGCCTATGGAGTTGTACTTAAACTCGAGTTTAAGTACAACTCCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003159.2-682s1c1
Sequence:CCGGCAGCCACAATGATGTCCTAAACTCGAGTTTAGGACATCATTGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003159.2-359s1c1
Sequence:CCGGCATGAAATTGTGGCGATCAAGCTCGAGCTTGATCGCCACAATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003159.x-2750s1c1
Sequence:CCGGACATCTCTCTTCGGCCTCAAACTCGAGTTTGAGGCCGAAGAGAGATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003159.x-438s1c1
Sequence:CCGGGTGGAGTTGAAGGAAGCATTTCTCGAGAAATGCTTCCTTCAACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003159.x-563s1c1
Sequence:CCGGCTACATCTATCAGCTAATCAACTCGAGTTGATTAGCTGATAGATGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003159.x-3004s1c1
Sequence:CCGGCGACAGAACAACAAGGAGAATCTCGAGATTCTCCTTGTTGTTCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003159.2-321s21c1
Sequence:CCGGCCTATGGAGTTGTACTTAAATCTCGAGATTTAAGTACAACTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003159.2-641s21c1
Sequence:CCGGGATATTGTCCATCGAGATATACTCGAGTATATCTCGATGGACAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003159.2-1643s21c1
Sequence:CCGGCAGAGTCGGCATAGCTATATTCTCGAGAATATAGCTATGCCGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003159
CDKL5 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase-like 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003159.2-320s1c1
Sequence:CCGGGCCTATGGAGTTGTACTTAAACTCGAGTTTAAGTACAACTCCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003159.2-682s1c1
Sequence:CCGGCAGCCACAATGATGTCCTAAACTCGAGTTTAGGACATCATTGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003159.2-359s1c1
Sequence:CCGGCATGAAATTGTGGCGATCAAGCTCGAGCTTGATCGCCACAATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003159.x-2750s1c1
Sequence:CCGGACATCTCTCTTCGGCCTCAAACTCGAGTTTGAGGCCGAAGAGAGATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003159.x-438s1c1
Sequence:CCGGGTGGAGTTGAAGGAAGCATTTCTCGAGAAATGCTTCCTTCAACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003159.x-563s1c1
Sequence:CCGGCTACATCTATCAGCTAATCAACTCGAGTTGATTAGCTGATAGATGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003159.x-3004s1c1
Sequence:CCGGCGACAGAACAACAAGGAGAATCTCGAGATTCTCCTTGTTGTTCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003159.2-321s21c1
Sequence:CCGGCCTATGGAGTTGTACTTAAATCTCGAGATTTAAGTACAACTCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003159.2-641s21c1
Sequence:CCGGGATATTGTCCATCGAGATATACTCGAGTATATCTCGATGGACAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003159.2-1643s21c1
Sequence:CCGGCAGAGTCGGCATAGCTATATTCTCGAGAATATAGCTATGCCGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_356367
CDKL5 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase-like 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000023094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356367.1-2196s1c1
Sequence:CCGGGCCAACAGTTTGCAGCTCTTACTCGAGTAAGAGCTGCAAACTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356367.1-1246s1c1
Sequence:CCGGCCCTGTCTAATAGAAACCAATCTCGAGATTGGTTTCTATTAGACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356367.1-1883s1c1
Sequence:CCGGGCACACTGATACGAGAACTTTCTCGAGAAAGTTCTCGTATCAGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356367.1-349s1c1
Sequence:CCGGCCTATGGAGTTGTACTTAAATCTCGAGATTTAAGTACAACTCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_356367
CDKL5 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase-like 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000023094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356367.1-2196s1c1
Sequence:CCGGGCCAACAGTTTGCAGCTCTTACTCGAGTAAGAGCTGCAAACTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356367.1-1246s1c1
Sequence:CCGGCCCTGTCTAATAGAAACCAATCTCGAGATTGGTTTCTATTAGACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356367.1-1883s1c1
Sequence:CCGGGCACACTGATACGAGAACTTTCTCGAGAAAGTTCTCGTATCAGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356367.1-349s1c1
Sequence:CCGGCCTATGGAGTTGTACTTAAATCTCGAGATTTAAGTACAACTCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_356367
CDKL5 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase-like 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000023094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356367.1-2196s1c1
Sequence:CCGGGCCAACAGTTTGCAGCTCTTACTCGAGTAAGAGCTGCAAACTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356367.1-1246s1c1
Sequence:CCGGCCCTGTCTAATAGAAACCAATCTCGAGATTGGTTTCTATTAGACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356367.1-1883s1c1
Sequence:CCGGGCACACTGATACGAGAACTTTCTCGAGAAAGTTCTCGTATCAGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356367.1-349s1c1
Sequence:CCGGCCTATGGAGTTGTACTTAAATCTCGAGATTTAAGTACAACTCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks