EMAIL THIS PAGE TO A FRIEND

CDKN1A

cyclin-dependent kinase inhibitor 1A (p21, Cip1)

115 Gene Product Result for
Synonyms: CAP20 CDKN1 CIP1 MDA-6 P21 SDI1 WAF1 p21CIP1
UniProtKB ID: P38936, Q14010, Q9BUT4
Gene ID:
Human(1026) Summary: This gene encodes a potent cyclin-dependent kinase inhibitor. The encoded protein binds to and inhibits the activity of cyclin-CDK2 or -CDK4 complexes, and thus functions as a regulator of cell cycle progression at G1. The expression of this gene is tightly controlled by the tumor suppressor protein p53, through which this protein mediates the p53-dependent cell cycle G1 phase arrest in response to a variety of stress stimuli. This protein can interact with proliferating cell nuclear antigen (PCNA), a DNA polymerase accessory factor, and plays a regulatory role in S phase DNA replication and DNA damage repair. This protein was reported to be specifically cleaved by CASP3-like caspases, which thus leads to a dramatic activation of CDK2, and may be instrumental in the execution of apoptosis following caspase activation. Multiple alternatively spliced variants have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(12575) cyclin-dependent kinase inhibitor 1A (P21)
Rat(114851) cyclin-dependent kinase inhibitor 1A
sheep(100302083) cyclin-dependent kinase inhibitor 1A (p21, Cip1)
domestic guinea pig(100720449) cyclin-dependent kinase inhibitor 1A (p21, Cip1)
naked mole-rat(101710552) cyclin-dependent kinase inhibitor 1A (p21, Cip1)
Zebrafish(100151416) cyclin-dependent kinase inhibitor 1A
cow(513497) cyclin-dependent kinase inhibitor 1A (p21, Cip1)
domestic cat(493943) cyclin-dependent kinase inhibitor 1A (p21, Cip1)
dog(474890) cyclin-dependent kinase inhibitor 1A (p21, Cip1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300419 Anti-CDKN1A (Ab-145) antibody produced in rabbit affinity isolated antibody human
western blot pricing
GW21164 Anti-CDKN1A antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
HPA005946 Anti-CDKN1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1306726 ANTI-MOUSE P21CIP1 (C-TERM S148) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
SAB4500065 Anti-p21 CIP1, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB1306168 ANTI-P21CIP1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4300166 Anti-phospho-CDKN1A (pThr145) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB1305570 ANTI-PHOSPHO-MOUSE P21CIP1(S125) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
pricing
SAB1305571 ANTI-PHOSPHO-MOUSE P21CIP1(S78) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
pricing
SAB4504494 Anti-phospho-p21 Cip1 (pThr145) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1305575 ANTI-PHOSPHO-P21CIP1(S130) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305631 ANTI-PHOSPHO-P21CIP1(S146) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306089 ANTI-PHOSPHO-P21CIP1(T145) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305627 ANTI-PHOSPHO-P21CIP1(T57) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
WH0001026M2 Monoclonal Anti-CDKN1A antibody produced in mouse clone 2F1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
P1484 Monoclonal Anti-p21WAF1/Cip1 antibody produced in mouse clone CP74, purified from hybridoma cell culture human, mouse
ELISA, immunoprecipitation, microarray, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
R7772 Roscovitine ≥98% (TLC) human, mouse, rat pricing
O0886 Olomoucine ≥98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000389 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000389 Rosetta Predictions human pricing
NM_078467 Rosetta Predictions human pricing
NM_080782 Rosetta Predictions rat pricing
NM_001111099 Rosetta Predictions mouse pricing
NM_007669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025255 predicted 819
2 SASI_Hs01_00025256 predicted 1000
3 SASI_Hs01_00025257 predicted 604
4 SASI_Hs01_00025258 predicted 445
5 SASI_Hs01_00025259 predicted 646
6 SASI_Hs01_00025260 predicted 447
7 SASI_Hs01_00025261 predicted 650
8 SASI_Hs01_00025262 predicted 875
9 SASI_Hs01_00025263 predicted 524
10 SASI_Hs01_00025264 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198706 predicted 938
2 SASI_Hs01_00198707 predicted 1115
3 SASI_Hs01_00198708 predicted 717
4 SASI_Hs01_00198709 predicted 558
5 SASI_Hs01_00198710 predicted 768
6 SASI_Hs01_00198711 predicted 564
7 SASI_Hs01_00198712 predicted 763
8 SASI_Hs01_00198713 predicted 983
9 SASI_Hs01_00198714 predicted 637
10 SASI_Hs01_00198715 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065715 predicted 463
2 SASI_Rn01_00065716 predicted 496
3 SASI_Rn01_00065717 predicted 359
4 SASI_Rn01_00065718 predicted 472
5 SASI_Rn01_00065719 predicted 208
6 SASI_Rn01_00065720 predicted 438
7 SASI_Rn01_00065721 predicted 360
8 SASI_Rn01_00065722 predicted 522
9 SASI_Rn02_00267302 predicted 375
10 SASI_Rn01_00065723 predicted 272
11 SASI_Rn01_00065724 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306392 predicted 536
2 SASI_Mm02_00306393 predicted 545
3 SASI_Mm02_00306394 predicted 506
4 SASI_Mm02_00306395 predicted 450
5 SASI_Mm02_00306396 predicted 621
6 SASI_Mm02_00306397 predicted 573
7 SASI_Mm02_00306398 predicted 257
8 SASI_Mm02_00306399 predicted 592
9 SASI_Mm02_00306400 predicted 473
10 SASI_Mm02_00306401 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086762 predicted 511
2 SASI_Mm01_00086763 predicted 516
3 SASI_Mm01_00086765 predicted 478
4 SASI_Mm01_00086767 predicted 426
5 SASI_Mm01_00086768 predicted 601
6 SASI_Mm01_00086769 predicted 545
7 SASI_Mm01_00086764 predicted 224
8 SASI_Mm02_00312176 predicted 574
9 SASI_Mm02_00312177 predicted 446
10 SASI_Mm02_00312178 predicted 232
11 SASI_Mm01_00086766 predicted 244
12 SASI_Mm01_00086770 predicted 177
13 SASI_Mm01_00086771 predicted 102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000389
VALIDATED
CDKN1A MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 1A (p21, Cip1)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-215s21c1
Sequence:CCGGCCGCGACTGTGATGCGCTAATCTCGAGATTAGCGCATCACAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-290s21c1
Sequence:CCGGGACACCACTGGAGGGTGACTTCTCGAGAAGTCACCCTCCAGTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-668s21c1
Sequence:CCGGCGCTCTACATCTTCTGCCTTACTCGAGTAAGGCAGAAGATGTAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-563s21c1
Sequence:CCGGGACAGATTTCTACCACTCCAACTCGAGTTGGAGTGGTAGAAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-434s21c1
Sequence:CCGGGACAGCAGAGGAAGACCATGTCTCGAGACATGGTCTTCCTCTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000389.x-526s1c1
Sequence:CCGGCTGATCTTCTCCAAGAGGAACTCGAGTTCCTCTTGGAGAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000389.x-934s1c1
Sequence:CCGGAGAGGTTCCTAAGAGTGCTGGCTCGAGCCAGCACTCTTAGGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000389.2-562s1c1
Sequence:CCGGGCTGATCTTCTCCAAGAGGAACTCGAGTTCCTCTTGGAGAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000389.2-640s1c1
Sequence:CCGGCGCTCTACATCTTCTGCCTTACTCGAGTAAGGCAGAAGATGTAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000389.2-433s1c1
Sequence:CCGGGTCACTGTCTTGTACCCTTGTCTCGAGACAAGGGTACAAGACAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000389.2-535s1c1
Sequence:CCGGGACAGATTTCTACCACTCCAACTCGAGTTGGAGTGGTAGAAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000389.2-233s1c1
Sequence:CCGGGAGCGATGGAACTTCGACTTTCTCGAGAAAGTCGAAGTTCCATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000389
VALIDATED
CDKN1A MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 1A (p21, Cip1)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-215s21c1
Sequence:CCGGCCGCGACTGTGATGCGCTAATCTCGAGATTAGCGCATCACAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-290s21c1
Sequence:CCGGGACACCACTGGAGGGTGACTTCTCGAGAAGTCACCCTCCAGTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-668s21c1
Sequence:CCGGCGCTCTACATCTTCTGCCTTACTCGAGTAAGGCAGAAGATGTAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-563s21c1
Sequence:CCGGGACAGATTTCTACCACTCCAACTCGAGTTGGAGTGGTAGAAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-434s21c1
Sequence:CCGGGACAGCAGAGGAAGACCATGTCTCGAGACATGGTCTTCCTCTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000389.x-526s1c1
Sequence:CCGGCTGATCTTCTCCAAGAGGAACTCGAGTTCCTCTTGGAGAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000389.x-934s1c1
Sequence:CCGGAGAGGTTCCTAAGAGTGCTGGCTCGAGCCAGCACTCTTAGGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000389.2-562s1c1
Sequence:CCGGGCTGATCTTCTCCAAGAGGAACTCGAGTTCCTCTTGGAGAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000389.2-640s1c1
Sequence:CCGGCGCTCTACATCTTCTGCCTTACTCGAGTAAGGCAGAAGATGTAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000389.2-433s1c1
Sequence:CCGGGTCACTGTCTTGTACCCTTGTCTCGAGACAAGGGTACAAGACAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000389.2-535s1c1
Sequence:CCGGGACAGATTTCTACCACTCCAACTCGAGTTGGAGTGGTAGAAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000389.2-233s1c1
Sequence:CCGGGAGCGATGGAACTTCGACTTTCTCGAGAAAGTCGAAGTTCCATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000389
VALIDATED
CDKN1A MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 1A (p21, Cip1)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-215s21c1
Sequence:CCGGCCGCGACTGTGATGCGCTAATCTCGAGATTAGCGCATCACAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-290s21c1
Sequence:CCGGGACACCACTGGAGGGTGACTTCTCGAGAAGTCACCCTCCAGTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-668s21c1
Sequence:CCGGCGCTCTACATCTTCTGCCTTACTCGAGTAAGGCAGAAGATGTAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-563s21c1
Sequence:CCGGGACAGATTTCTACCACTCCAACTCGAGTTGGAGTGGTAGAAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000389.3-434s21c1
Sequence:CCGGGACAGCAGAGGAAGACCATGTCTCGAGACATGGTCTTCCTCTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000389.x-526s1c1
Sequence:CCGGCTGATCTTCTCCAAGAGGAACTCGAGTTCCTCTTGGAGAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000389.x-934s1c1
Sequence:CCGGAGAGGTTCCTAAGAGTGCTGGCTCGAGCCAGCACTCTTAGGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000389.2-562s1c1
Sequence:CCGGGCTGATCTTCTCCAAGAGGAACTCGAGTTCCTCTTGGAGAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000389.2-640s1c1
Sequence:CCGGCGCTCTACATCTTCTGCCTTACTCGAGTAAGGCAGAAGATGTAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000389.2-433s1c1
Sequence:CCGGGTCACTGTCTTGTACCCTTGTCTCGAGACAAGGGTACAAGACAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000389.2-535s1c1
Sequence:CCGGGACAGATTTCTACCACTCCAACTCGAGTTGGAGTGGTAGAAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000389.2-233s1c1
Sequence:CCGGGAGCGATGGAACTTCGACTTTCTCGAGAAAGTCGAAGTTCCATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007669
CDKN1A MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 1A (p21, Cip1)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-134s1c1
Sequence:CCGGACAGGAGCAAAGTGTGCCGTTCTCGAGAACGGCACACTTTGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-448s1c1
Sequence:CCGGCTGGTGTCTGAGCGGCCTGAACTCGAGTTCAGGCCGCTCAGACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-516s1c1
Sequence:CCGGGACCAGCCTGACAGATTTCTACTCGAGTAGAAATCTGTCAGGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-485s1c1
Sequence:CCGGCCGGAACATCTCAGGGCCGAACTCGAGTTCGGCCCTGAGATGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-551s1c1
Sequence:CCGGGATTGGTCTTCTGCAAGAGAACTCGAGTTCTCTTGCAGAAGACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-229s1c1
Sequence:CCGGGCCCGAGAACGGTGGAACTTTCTCGAGAAAGTTCCACCGTTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-534s1c1
Sequence:CCGGCTATCACTCCAAGCGCAGATTCTCGAGAATCTGCGCTTGGAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-243s1c1
Sequence:CCGGGAACTTTGACTTCGTCACGGACTCGAGTCCGTGACGAAGTCAAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-525s1c1
Sequence:CCGGGACAGATTTCTATCACTCCAACTCGAGTTGGAGTGATAGAAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-175s1c1
Sequence:CCGGAGTGAGCAGTTGCGCCGTGATCTCGAGATCACGGCGCAACTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007669
CDKN1A MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 1A (p21, Cip1)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-134s1c1
Sequence:CCGGACAGGAGCAAAGTGTGCCGTTCTCGAGAACGGCACACTTTGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-448s1c1
Sequence:CCGGCTGGTGTCTGAGCGGCCTGAACTCGAGTTCAGGCCGCTCAGACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-516s1c1
Sequence:CCGGGACCAGCCTGACAGATTTCTACTCGAGTAGAAATCTGTCAGGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-485s1c1
Sequence:CCGGCCGGAACATCTCAGGGCCGAACTCGAGTTCGGCCCTGAGATGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-551s1c1
Sequence:CCGGGATTGGTCTTCTGCAAGAGAACTCGAGTTCTCTTGCAGAAGACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-229s1c1
Sequence:CCGGGCCCGAGAACGGTGGAACTTTCTCGAGAAAGTTCCACCGTTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-534s1c1
Sequence:CCGGCTATCACTCCAAGCGCAGATTCTCGAGAATCTGCGCTTGGAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-243s1c1
Sequence:CCGGGAACTTTGACTTCGTCACGGACTCGAGTCCGTGACGAAGTCAAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-525s1c1
Sequence:CCGGGACAGATTTCTATCACTCCAACTCGAGTTGGAGTGATAGAAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-175s1c1
Sequence:CCGGAGTGAGCAGTTGCGCCGTGATCTCGAGATCACGGCGCAACTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007669
CDKN1A MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 1A (p21, Cip1)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-134s1c1
Sequence:CCGGACAGGAGCAAAGTGTGCCGTTCTCGAGAACGGCACACTTTGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-448s1c1
Sequence:CCGGCTGGTGTCTGAGCGGCCTGAACTCGAGTTCAGGCCGCTCAGACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-516s1c1
Sequence:CCGGGACCAGCCTGACAGATTTCTACTCGAGTAGAAATCTGTCAGGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-485s1c1
Sequence:CCGGCCGGAACATCTCAGGGCCGAACTCGAGTTCGGCCCTGAGATGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-551s1c1
Sequence:CCGGGATTGGTCTTCTGCAAGAGAACTCGAGTTCTCTTGCAGAAGACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-229s1c1
Sequence:CCGGGCCCGAGAACGGTGGAACTTTCTCGAGAAAGTTCCACCGTTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-534s1c1
Sequence:CCGGCTATCACTCCAAGCGCAGATTCTCGAGAATCTGCGCTTGGAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-243s1c1
Sequence:CCGGGAACTTTGACTTCGTCACGGACTCGAGTCCGTGACGAAGTCAAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-525s1c1
Sequence:CCGGGACAGATTTCTATCACTCCAACTCGAGTTGGAGTGATAGAAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007669.2-175s1c1
Sequence:CCGGAGTGAGCAGTTGCGCCGTGATCTCGAGATCACGGCGCAACTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks