EMAIL THIS PAGE TO A FRIEND

CDKN1B

cyclin-dependent kinase inhibitor 1B (p27, Kip1)

Synonyms: CDKN4 KIP1 MEN1B MEN4 P27KIP1
UniProtKB ID: P46527, Q16307, Q5U0H2, Q9BUS6
Gene ID:
Human(1027) Summary: This gene encodes a cyclin-dependent kinase inhibitor, which shares a limited similarity with CDK inhibitor CDKN1A/p21. The encoded protein binds to and prevents the activation of cyclin E-CDK2 or cyclin D-CDK4 complexes, and thus controls the cell cycle progression at G1. The degradation of this protein, which is triggered by its CDK dependent phosphorylation and subsequent ubiquitination by SCF complexes, is required for the cellular transition from quiescence to the proliferative state. [provided by RefSeq, Jul 2008]
Mouse(12576) cyclin-dependent kinase inhibitor 1B
Rat(83571) cyclin-dependent kinase inhibitor 1B
chicken(374106) cyclin-dependent kinase inhibitor 1B (p27, Kip1)
dog(403429) cyclin-dependent kinase inhibitor 1B (p27, Kip1)
cow(512613) cyclin-dependent kinase inhibitor 1B (p27, Kip1)
domestic cat(493958) cyclin-dependent kinase inhibitor 1B (p27, Kip1)
chicken(769872) cyclin-dependent kinase inhibitor 1B (p27, Kip1)
naked mole-rat(101698721) cyclin-dependent kinase inhibitor 1B (p27, Kip1)
domestic guinea pig(100729359) cyclin-dependent kinase inhibitor 1B (p27, Kip1)
sheep(100127219) cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Domestic Rabbit(100009037) cyclin-dependent kinase inhibitor 1B (p27, Kip1)
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306165 ANTI-27KIP1(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1105682 Anti-CDKN1B (151-165) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105681 Anti-CDKN1B (56-70) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB4300420 Anti-CDKN1B (Ab-10) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
GW21985 Anti-CDKN1B antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
GW22609 Anti-CDKN1B antibody produced in chicken affinity isolated antibody, buffered aqueous solution chicken
western blot pricing
SAB1405601 Anti-CDKN1B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2100391 Anti-CDKN1B antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA059086 Anti-CDKN1B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2500562 Anti-KIP1/CDKN1B, Internal antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, cat, human
ELISA, immunohistochemistry, western blot pricing
SAB1306720 ANTI-MOUSE P27KIP1 (C-TERM T197) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
SAB4500067 Anti-p27 KIP1, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4500069 Anti-p27 KIP1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4500068 Anti-p27 KIP1, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB1306621 ANTI-P27KIP1 (N-TERM S12) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
SAB2500733 Anti-P27KIP1/CDKN1B, C-Terminal antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine, rat, canine, mouse
ELISA, western blot pricing
SAB4300167 Anti-phospho-CDKN1B (pThr187) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB1305621 ANTI-PHOSPHO-MOUSE P27KIP1(T197) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
pricing
SAB4504495 Anti-phospho-p27 Kip1 (pSer10) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504496 Anti-phospho-p27 Kip1 (pThr187) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504200 Anti-phospho-p27 Kip1 (pThr198) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301543 Anti-phospho-p27 Kip1 (pThr198) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1306308 ANTI-PHOSPHO-P27KIP1(S10) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305618 ANTI-PHOSPHO-P27KIP1(S140) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1306309 ANTI-PHOSPHO-P27KIP1(S178) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305619 ANTI-PHOSPHO-P27KIP1(S83) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305628 ANTI-PHOSPHO-P27KIP1(T157) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB1305620 ANTI-PHOSPHO-P27KIP1(T170) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1306298 ANTI-PHOSPHO-P27KIP1(T187) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305582 ANTI-PHOSPHO-P27KIP1(T198) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
WH0001027M1 Monoclonal Anti-CDKN1B antibody produced in mouse clone 4B4-E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403659 Monoclonal Anti-CDKN1B, (C-terminal) antibody produced in mouse clone 2F4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
P2092 Monoclonal Anti-p27Kip1 antibody produced in mouse clone DCS-72, ascites fluid rat, canine, human, mouse, monkey
immunocytochemistry, immunoprecipitation, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
R7772 Roscovitine ≥98% (TLC) human, mouse, rat pricing
O0886 Olomoucine ≥98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004064 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004064 siRNAs that have been validated in the lab human pricing
NM_031762 Rosetta Predictions rat pricing
NM_009875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004064 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113637 validated 1165
2 SASI_Hs01_00113638 predicted 1279
3 SASI_Hs01_00113639 predicted 1401
4 SASI_Hs02_00336849 predicted 1118
5 SASI_Hs01_00113643 predicted 1265
6 SASI_Hs02_00336850 predicted 1175
7 SASI_Hs01_00113644 predicted 1038
8 SASI_Hs01_00113645 predicted 1500
9 SASI_Hs02_00336851 predicted 1251
10 SASI_Hs02_00336852 predicted 1300
11 SASI_Hs01_00113640 predicted 1118
12 SASI_Hs01_00113641 predicted 936
13 SASI_Hs01_00113642 predicted 1520
14 SASI_Hs01_00113646 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087579 predicted 893
2 SASI_Rn01_00087580 predicted 531
3 SASI_Rn02_00265180 predicted 672
4 SASI_Rn01_00087581 predicted 658
5 SASI_Rn01_00087582 predicted 934
6 SASI_Rn01_00087583 predicted 772
7 SASI_Rn01_00087584 predicted 836
8 SASI_Rn01_00087585 predicted 546
9 SASI_Rn02_00265181 predicted 207
10 SASI_Rn01_00087587 predicted 871
11 SASI_Rn01_00087586 predicted 807
12 SASI_Rn01_00087588 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317345 predicted 901
2 SASI_Mm02_00317346 predicted 1113
3 SASI_Mm02_00317347 predicted 1107
4 SASI_Mm01_00104471 predicted 982
5 SASI_Mm01_00104477 predicted 1090
6 SASI_Mm02_00317348 predicted 1219
7 SASI_Mm02_00317349 predicted 1279
8 SASI_Mm01_00104474 predicted 909
9 SASI_Mm01_00104475 predicted 808
10 SASI_Mm01_00104478 predicted 929
11 SASI_Mm01_00104469 predicted 1186
12 SASI_Mm01_00104470 predicted 1078
13 SASI_Mm01_00104472 predicted 977
14 SASI_Mm01_00104473 predicted 1210
15 SASI_Mm01_00104476 predicted 1379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004064
VALIDATED
CDKN1B MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004064.2-2050s1c1
Sequence:CCGGGTAGGATAAGTGAAATGGATACTCGAGTATCCATTTCACTTATCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004064.2-634s1c1
Sequence:CCGGCAGCGCAAGTGGAATTTCGATCTCGAGATCGAAATTCCACTTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004064.2-1041s1c1
Sequence:CCGGCCTCAGAAGACGTCAAACGTACTCGAGTACGTTTGACGTCTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004064.2-636s1c1
Sequence:CCGGGCGCAAGTGGAATTTCGATTTCTCGAGAAATCGAAATTCCACTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004064.x-901s1c1
Sequence:CCGGAGCAATGCGCAGGAATAAGGCTCGAGCCTTATTCCTGCGCATTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004064.x-2043s1c1
Sequence:CCGGCACACTTGTAGGATAAGTGAACTCGAGTTCACTTATCCTACAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-576s21c1
Sequence:CCGGCGGTGGACCACGAAGAGTTAACTCGAGTTAACTCTTCGTGGTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-643s21c1
Sequence:CCGGGCGCAAGTGGAATTTCGATTTCTCGAGAAATCGAAATTCCACTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004064.3-1269s21c1
Sequence:CCGGGATGTAGCATTATGCAATTAGCTCGAGCTAATTGCATAATGCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-720s21c1
Sequence:CCGGGCTTGCCCGAGTTCTACTACACTCGAGTGTAGTAGAACTCGGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-841s21c1
Sequence:CCGGTAACTCTGAGGACACGCATTTCTCGAGAAATGCGTGTCCTCAGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004064.3-1177s21c1
Sequence:CCGGGGAATGGACATCCTGTATAAGCTCGAGCTTATACAGGATGTCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-1064s21c1
Sequence:CCGGACGTAAACAGCTCGAATTAAGCTCGAGCTTAATTCGAGCTGTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004064
VALIDATED
CDKN1B MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004064.2-2050s1c1
Sequence:CCGGGTAGGATAAGTGAAATGGATACTCGAGTATCCATTTCACTTATCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004064.2-634s1c1
Sequence:CCGGCAGCGCAAGTGGAATTTCGATCTCGAGATCGAAATTCCACTTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004064.2-1041s1c1
Sequence:CCGGCCTCAGAAGACGTCAAACGTACTCGAGTACGTTTGACGTCTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004064.2-636s1c1
Sequence:CCGGGCGCAAGTGGAATTTCGATTTCTCGAGAAATCGAAATTCCACTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004064.x-901s1c1
Sequence:CCGGAGCAATGCGCAGGAATAAGGCTCGAGCCTTATTCCTGCGCATTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004064.x-2043s1c1
Sequence:CCGGCACACTTGTAGGATAAGTGAACTCGAGTTCACTTATCCTACAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-576s21c1
Sequence:CCGGCGGTGGACCACGAAGAGTTAACTCGAGTTAACTCTTCGTGGTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-643s21c1
Sequence:CCGGGCGCAAGTGGAATTTCGATTTCTCGAGAAATCGAAATTCCACTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004064.3-1269s21c1
Sequence:CCGGGATGTAGCATTATGCAATTAGCTCGAGCTAATTGCATAATGCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-720s21c1
Sequence:CCGGGCTTGCCCGAGTTCTACTACACTCGAGTGTAGTAGAACTCGGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-841s21c1
Sequence:CCGGTAACTCTGAGGACACGCATTTCTCGAGAAATGCGTGTCCTCAGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004064.3-1177s21c1
Sequence:CCGGGGAATGGACATCCTGTATAAGCTCGAGCTTATACAGGATGTCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-1064s21c1
Sequence:CCGGACGTAAACAGCTCGAATTAAGCTCGAGCTTAATTCGAGCTGTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004064
VALIDATED
CDKN1B MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004064.2-2050s1c1
Sequence:CCGGGTAGGATAAGTGAAATGGATACTCGAGTATCCATTTCACTTATCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004064.2-634s1c1
Sequence:CCGGCAGCGCAAGTGGAATTTCGATCTCGAGATCGAAATTCCACTTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004064.2-1041s1c1
Sequence:CCGGCCTCAGAAGACGTCAAACGTACTCGAGTACGTTTGACGTCTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004064.2-636s1c1
Sequence:CCGGGCGCAAGTGGAATTTCGATTTCTCGAGAAATCGAAATTCCACTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004064.x-901s1c1
Sequence:CCGGAGCAATGCGCAGGAATAAGGCTCGAGCCTTATTCCTGCGCATTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004064.x-2043s1c1
Sequence:CCGGCACACTTGTAGGATAAGTGAACTCGAGTTCACTTATCCTACAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-576s21c1
Sequence:CCGGCGGTGGACCACGAAGAGTTAACTCGAGTTAACTCTTCGTGGTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-643s21c1
Sequence:CCGGGCGCAAGTGGAATTTCGATTTCTCGAGAAATCGAAATTCCACTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004064.3-1269s21c1
Sequence:CCGGGATGTAGCATTATGCAATTAGCTCGAGCTAATTGCATAATGCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-720s21c1
Sequence:CCGGGCTTGCCCGAGTTCTACTACACTCGAGTGTAGTAGAACTCGGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-841s21c1
Sequence:CCGGTAACTCTGAGGACACGCATTTCTCGAGAAATGCGTGTCCTCAGAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004064.3-1177s21c1
Sequence:CCGGGGAATGGACATCCTGTATAAGCTCGAGCTTATACAGGATGTCCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004064.3-1064s21c1
Sequence:CCGGACGTAAACAGCTCGAATTAAGCTCGAGCTTAATTCGAGCTGTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009875
VALIDATED
CDKN1B MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009875.2-620s1c1
Sequence:CCGGTGAAGAACTAACCCGGGACTTCTCGAGAAGTCCCGGGTTAGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009875.2-855s1c1
Sequence:CCGGCCTTTAATTGGGTCTCAGGCACTCGAGTGCCTGAGACCCAATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009875.2-608s1c1
Sequence:CCGGCCCGGTCAATCATGAAGAACTCTCGAGAGTTCTTCATGATTGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009875.2-678s1c1
Sequence:CCGGCGCAAGTGGAATTTCGACTTTCTCGAGAAAGTCGAAATTCCACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009875.2-887s1c1
Sequence:CCGGCCGGCATTTGGTGGACCAAATCTCGAGATTTGGTCCACCAAATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-621s21c1
Sequence:CCGGCCCGGTCAATCATGAAGAACTCTCGAGAGTTCTTCATGATTGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-691s21c1
Sequence:CCGGCGCAAGTGGAATTTCGACTTTCTCGAGAAAGTCGAAATTCCACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-1310s21c1
Sequence:CCGGGATGTAGCATTGCGCAATTAGCTCGAGCTAATTGCGCAATGCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-1108s21c1
Sequence:CCGGACGTAAACAGCTCCGAATTAACTCGAGTTAATTCGGAGCTGTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-767s21c1
Sequence:CCGGGCTTGCCCGAGTTCTACTACACTCGAGTGTAGTAGAACTCGGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009875
VALIDATED
CDKN1B MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009875.2-620s1c1
Sequence:CCGGTGAAGAACTAACCCGGGACTTCTCGAGAAGTCCCGGGTTAGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009875.2-855s1c1
Sequence:CCGGCCTTTAATTGGGTCTCAGGCACTCGAGTGCCTGAGACCCAATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009875.2-608s1c1
Sequence:CCGGCCCGGTCAATCATGAAGAACTCTCGAGAGTTCTTCATGATTGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009875.2-678s1c1
Sequence:CCGGCGCAAGTGGAATTTCGACTTTCTCGAGAAAGTCGAAATTCCACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009875.2-887s1c1
Sequence:CCGGCCGGCATTTGGTGGACCAAATCTCGAGATTTGGTCCACCAAATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-621s21c1
Sequence:CCGGCCCGGTCAATCATGAAGAACTCTCGAGAGTTCTTCATGATTGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-691s21c1
Sequence:CCGGCGCAAGTGGAATTTCGACTTTCTCGAGAAAGTCGAAATTCCACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-1310s21c1
Sequence:CCGGGATGTAGCATTGCGCAATTAGCTCGAGCTAATTGCGCAATGCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-1108s21c1
Sequence:CCGGACGTAAACAGCTCCGAATTAACTCGAGTTAATTCGGAGCTGTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-767s21c1
Sequence:CCGGGCTTGCCCGAGTTCTACTACACTCGAGTGTAGTAGAACTCGGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009875
VALIDATED
CDKN1B MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009875.2-620s1c1
Sequence:CCGGTGAAGAACTAACCCGGGACTTCTCGAGAAGTCCCGGGTTAGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009875.2-855s1c1
Sequence:CCGGCCTTTAATTGGGTCTCAGGCACTCGAGTGCCTGAGACCCAATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009875.2-608s1c1
Sequence:CCGGCCCGGTCAATCATGAAGAACTCTCGAGAGTTCTTCATGATTGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009875.2-678s1c1
Sequence:CCGGCGCAAGTGGAATTTCGACTTTCTCGAGAAAGTCGAAATTCCACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009875.2-887s1c1
Sequence:CCGGCCGGCATTTGGTGGACCAAATCTCGAGATTTGGTCCACCAAATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-621s21c1
Sequence:CCGGCCCGGTCAATCATGAAGAACTCTCGAGAGTTCTTCATGATTGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-691s21c1
Sequence:CCGGCGCAAGTGGAATTTCGACTTTCTCGAGAAAGTCGAAATTCCACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-1310s21c1
Sequence:CCGGGATGTAGCATTGCGCAATTAGCTCGAGCTAATTGCGCAATGCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-1108s21c1
Sequence:CCGGACGTAAACAGCTCCGAATTAACTCGAGTTAATTCGGAGCTGTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009875.4-767s21c1
Sequence:CCGGGCTTGCCCGAGTTCTACTACACTCGAGTGTAGTAGAACTCGGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks