EMAIL THIS PAGE TO A FRIEND

CDKN1C

cyclin-dependent kinase inhibitor 1C (p57, Kip2)

140 Gene Product Result for
Synonyms: BWCR BWS KIP2 WBS p57 p57Kip2
UniProtKB ID: P49918
Gene ID:
Human(1028) Summary: This gene is imprinted, with preferential expression of the maternal allele. The encoded protein is a tight-binding, strong inhibitor of several G1 cyclin/Cdk complexes and a negative regulator of cell proliferation. Mutations in this gene are implicated in sporadic cancers and Beckwith-Wiedemann syndorome, suggesting that this gene is a tumor suppressor candidate. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Mouse(12577) cyclin-dependent kinase inhibitor 1C (P57)
Rat(246060) cyclin-dependent kinase inhibitor 1C
Zebrafish(399483) cyclin-dependent kinase inhibitor 1C
cow(510972) cyclin-dependent kinase inhibitor 1C (p57, Kip2)
sheep(100216434) cyclin-dependent kinase inhibitor 1C (p57, Kip2)
naked mole-rat(101726530) cyclin-dependent kinase inhibitor 1C (p57, Kip2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
R7772 Roscovitine ≥98% (TLC) human, mouse, rat pricing
O0886 Olomoucine ≥98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000076 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU028861 MISSION® esiRNA esiRNA targeting mouse Cdkn1c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000076 Rosetta Predictions human pricing
NM_001122630 Rosetta Predictions human pricing
NM_001122631 Rosetta Predictions human pricing
NM_001033757 Rosetta Predictions rat pricing
NM_001033758 Rosetta Predictions rat pricing
NM_182735 Rosetta Predictions rat pricing
NM_009876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091600 predicted 511
2 SASI_Hs02_00301809 predicted 491
3 SASI_Hs02_00301810 predicted 500
4 SASI_Hs02_00301811 predicted 1080
5 SASI_Hs02_00301812 predicted 1625
6 SASI_Hs02_00301813 predicted 1632
7 SASI_Hs02_00301814 predicted 1380
8 SASI_Hs02_00301815 predicted 1438
9 SASI_Hs02_00301816 predicted 1667
10 SASI_Hs02_00301817 predicted 1432
11 SASI_Hs01_00091595 predicted 1204
12 SASI_Hs01_00091596 predicted 1133
13 SASI_Hs01_00091597 predicted 1276
14 SASI_Hs01_00091598 predicted 1134
15 SASI_Hs01_00091599 predicted 1280
16 SASI_Hs01_00091601 predicted 1109
17 SASI_Hs01_00091602 predicted 1212
18 SASI_Hs01_00091603 predicted 1284
19 SASI_Hs01_00091604 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327086 predicted 336
2 SASI_Hs02_00327087 predicted 329
3 SASI_Hs02_00327088 predicted 328
4 SASI_Hs02_00327089 predicted 915
5 SASI_Hs02_00327090 predicted 1456
6 SASI_Hs02_00327091 predicted 1474
7 SASI_Hs02_00327092 predicted 1215
8 SASI_Hs02_00327093 predicted 1273
9 SASI_Hs02_00327094 predicted 1269
10 SASI_Hs02_00327095 predicted 1494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327096 predicted 336
2 SASI_Hs02_00327097 predicted 333
3 SASI_Hs02_00327098 predicted 327
4 SASI_Hs02_00327099 predicted 909
5 SASI_Hs02_00327100 predicted 1453
6 SASI_Hs02_00327101 predicted 1468
7 SASI_Hs02_00327102 predicted 1210
8 SASI_Hs02_00327103 predicted 1268
9 SASI_Hs02_00327104 predicted 1496
10 SASI_Hs02_00327105 predicted 1260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047818 predicted 759
2 SASI_Rn01_00047819 predicted 906
3 SASI_Rn01_00047821 predicted 921
4 SASI_Rn01_00047822 predicted 516
5 SASI_Rn02_00203756 predicted 844
6 SASI_Rn01_00047823 predicted 839
7 SASI_Rn01_00047824 predicted 533
8 SASI_Rn02_00203757 predicted 937
9 SASI_Rn01_00047826 predicted 808
10 SASI_Rn01_00047827 predicted 763
11 SASI_Rn01_00047820 predicted 874
12 SASI_Rn01_00047825 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078759 predicted 760
2 SASI_Rn01_00078760 predicted 914
3 SASI_Rn01_00078762 predicted 918
4 SASI_Rn01_00078763 predicted 521
5 SASI_Rn02_00203758 predicted 836
6 SASI_Rn01_00078764 predicted 841
7 SASI_Rn01_00078765 predicted 533
8 SASI_Rn02_00203759 predicted 936
9 SASI_Rn01_00078767 predicted 812
10 SASI_Rn01_00078768 predicted 768
11 SASI_Rn01_00078761 predicted 872
12 SASI_Rn01_00078766 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063969 predicted 625
2 SASI_Rn01_00063970 predicted 771
3 SASI_Rn01_00063972 predicted 789
4 SASI_Rn01_00063973 predicted 386
5 SASI_Rn02_00269832 predicted 701
6 SASI_Rn01_00063974 predicted 699
7 SASI_Rn01_00063975 predicted 398
8 SASI_Rn02_00269833 predicted 798
9 SASI_Rn01_00063977 predicted 669
10 SASI_Rn01_00063978 predicted 628
11 SASI_Rn01_00063971 predicted 733
12 SASI_Rn01_00063976 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144085 predicted 1143
2 SASI_Mm01_00144086 predicted 742
3 SASI_Mm01_00144087 predicted 756
4 SASI_Mm01_00144088 predicted 1146
5 SASI_Mm01_00144089 predicted 289
6 SASI_Mm01_00144092 predicted 373
7 SASI_Mm01_00144093 predicted 211
8 SASI_Mm01_00144094 predicted 605
9 SASI_Mm02_00317350 predicted 1016
10 SASI_Mm02_00317351 predicted 1144
11 SASI_Mm01_00144090 predicted 365
12 SASI_Mm01_00144091 predicted 1182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000076
VALIDATED
CDKN1C MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 1C (p57, Kip2)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000076.2-1451s21c1
Sequence:CCGGGTAAAGCTTTAAGAGTCATTTCTCGAGAAATGACTCTTAAAGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000076.2-1628s21c1
Sequence:CCGGCCACGCACTAGCTCGGTTATTCTCGAGAATAACCGAGCTAGTGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000076.2-1082s21c1
Sequence:CCGGGGCCTCTGATCTCCGATTTCTCTCGAGAGAAATCGGAGATCAGAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000076.2-1216s21c1
Sequence:CCGGAGGCTGCGGTGAGCCAATTTACTCGAGTAAATTGGCTCACCGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000076.2-303s21c1
Sequence:CCGGATCCACGATGGAGCGTCTTGTCTCGAGACAAGACGCTCCATCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000076.2-450s21c1
Sequence:CCGGGAACCGCTGGGATTACGACTTCTCGAGAAGTCGTAATCCCAGCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000076.2-1089s21c1
Sequence:CCGGGATCTCCGATTTCTTCGCCAACTCGAGTTGGCGAAGAAATCGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000076.2-1113s21c1
Sequence:CCGGCAAGAGATCAGCGCCTGAGAACTCGAGTTCTCAGGCGCTGATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.x-285s1c1
Sequence:CCGGACATCCACGATGGAGCGTCTTCTCGAGAAGACGCTCCATCGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.x-431s1c1
Sequence:CCGGCCAGAACCGCTGGGATTACGACTCGAGTCGTAATCCCAGCGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.x-1399s1c1
Sequence:CCGGTATTCTGCACGAGAAGGTACACTCGAGTGTACCTTCTCGTGCAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.1-1067s1c1
Sequence:CCGGGCCTCTGATCTCCGATTTCTTCTCGAGAAGAAATCGGAGATCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000076.1-437s1c1
Sequence:CCGGCCGCTGGGATTACGACTTCCACTCGAGTGGAAGTCGTAATCCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.1-1073s1c1
Sequence:CCGGGATCTCCGATTTCTTCGCCAACTCGAGTTGGCGAAGAAATCGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000076
VALIDATED
CDKN1C MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 1C (p57, Kip2)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000076.2-1451s21c1
Sequence:CCGGGTAAAGCTTTAAGAGTCATTTCTCGAGAAATGACTCTTAAAGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000076.2-1628s21c1
Sequence:CCGGCCACGCACTAGCTCGGTTATTCTCGAGAATAACCGAGCTAGTGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000076.2-1082s21c1
Sequence:CCGGGGCCTCTGATCTCCGATTTCTCTCGAGAGAAATCGGAGATCAGAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000076.2-1216s21c1
Sequence:CCGGAGGCTGCGGTGAGCCAATTTACTCGAGTAAATTGGCTCACCGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000076.2-303s21c1
Sequence:CCGGATCCACGATGGAGCGTCTTGTCTCGAGACAAGACGCTCCATCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000076.2-450s21c1
Sequence:CCGGGAACCGCTGGGATTACGACTTCTCGAGAAGTCGTAATCCCAGCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000076.2-1089s21c1
Sequence:CCGGGATCTCCGATTTCTTCGCCAACTCGAGTTGGCGAAGAAATCGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000076.2-1113s21c1
Sequence:CCGGCAAGAGATCAGCGCCTGAGAACTCGAGTTCTCAGGCGCTGATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.x-285s1c1
Sequence:CCGGACATCCACGATGGAGCGTCTTCTCGAGAAGACGCTCCATCGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.x-431s1c1
Sequence:CCGGCCAGAACCGCTGGGATTACGACTCGAGTCGTAATCCCAGCGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.x-1399s1c1
Sequence:CCGGTATTCTGCACGAGAAGGTACACTCGAGTGTACCTTCTCGTGCAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.1-1067s1c1
Sequence:CCGGGCCTCTGATCTCCGATTTCTTCTCGAGAAGAAATCGGAGATCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000076.1-437s1c1
Sequence:CCGGCCGCTGGGATTACGACTTCCACTCGAGTGGAAGTCGTAATCCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.1-1073s1c1
Sequence:CCGGGATCTCCGATTTCTTCGCCAACTCGAGTTGGCGAAGAAATCGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000076
VALIDATED
CDKN1C MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 1C (p57, Kip2)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000076.2-1451s21c1
Sequence:CCGGGTAAAGCTTTAAGAGTCATTTCTCGAGAAATGACTCTTAAAGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000076.2-1628s21c1
Sequence:CCGGCCACGCACTAGCTCGGTTATTCTCGAGAATAACCGAGCTAGTGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000076.2-1082s21c1
Sequence:CCGGGGCCTCTGATCTCCGATTTCTCTCGAGAGAAATCGGAGATCAGAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000076.2-1216s21c1
Sequence:CCGGAGGCTGCGGTGAGCCAATTTACTCGAGTAAATTGGCTCACCGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000076.2-303s21c1
Sequence:CCGGATCCACGATGGAGCGTCTTGTCTCGAGACAAGACGCTCCATCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000076.2-450s21c1
Sequence:CCGGGAACCGCTGGGATTACGACTTCTCGAGAAGTCGTAATCCCAGCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000076.2-1089s21c1
Sequence:CCGGGATCTCCGATTTCTTCGCCAACTCGAGTTGGCGAAGAAATCGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000076.2-1113s21c1
Sequence:CCGGCAAGAGATCAGCGCCTGAGAACTCGAGTTCTCAGGCGCTGATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.x-285s1c1
Sequence:CCGGACATCCACGATGGAGCGTCTTCTCGAGAAGACGCTCCATCGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.x-431s1c1
Sequence:CCGGCCAGAACCGCTGGGATTACGACTCGAGTCGTAATCCCAGCGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.x-1399s1c1
Sequence:CCGGTATTCTGCACGAGAAGGTACACTCGAGTGTACCTTCTCGTGCAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.1-1067s1c1
Sequence:CCGGGCCTCTGATCTCCGATTTCTTCTCGAGAAGAAATCGGAGATCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000076.1-437s1c1
Sequence:CCGGCCGCTGGGATTACGACTTCCACTCGAGTGGAAGTCGTAATCCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000076.1-1073s1c1
Sequence:CCGGGATCTCCGATTTCTTCGCCAACTCGAGTTGGCGAAGAAATCGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009876
CDKN1C MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 1C (p57, Kip2)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009876.2-1694s1c1
Sequence:CCGGCCACACATTCATCTTCAGTTACTCGAGTAACTGAAGATGAATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009876.2-1060s1c1
Sequence:CCGGGCAGGAGAACAAGGCGTCGAACTCGAGTTCGACGCCTTGTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009876.2-215s1c1
Sequence:CCGGCGCAGCCTCTTCGGGCCTGTACTCGAGTACAGGCCCGAAGAGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009876.2-920s1c1
Sequence:CCGGGTCGAGGAGCAGGACGAGAATCTCGAGATTCTCGTCCTGCTCCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009876.2-308s1c1
Sequence:CCGGGACTTCAACTTCCAGCAGGATCTCGAGATCCTGCTGGAAGTTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009876
CDKN1C MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 1C (p57, Kip2)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009876.2-1694s1c1
Sequence:CCGGCCACACATTCATCTTCAGTTACTCGAGTAACTGAAGATGAATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009876.2-1060s1c1
Sequence:CCGGGCAGGAGAACAAGGCGTCGAACTCGAGTTCGACGCCTTGTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009876.2-215s1c1
Sequence:CCGGCGCAGCCTCTTCGGGCCTGTACTCGAGTACAGGCCCGAAGAGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009876.2-920s1c1
Sequence:CCGGGTCGAGGAGCAGGACGAGAATCTCGAGATTCTCGTCCTGCTCCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009876.2-308s1c1
Sequence:CCGGGACTTCAACTTCCAGCAGGATCTCGAGATCCTGCTGGAAGTTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009876
CDKN1C MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 1C (p57, Kip2)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009876.2-1694s1c1
Sequence:CCGGCCACACATTCATCTTCAGTTACTCGAGTAACTGAAGATGAATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009876.2-1060s1c1
Sequence:CCGGGCAGGAGAACAAGGCGTCGAACTCGAGTTCGACGCCTTGTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009876.2-215s1c1
Sequence:CCGGCGCAGCCTCTTCGGGCCTGTACTCGAGTACAGGCCCGAAGAGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009876.2-920s1c1
Sequence:CCGGGTCGAGGAGCAGGACGAGAATCTCGAGATTCTCGTCCTGCTCCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009876.2-308s1c1
Sequence:CCGGGACTTCAACTTCCAGCAGGATCTCGAGATCCTGCTGGAAGTTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks