EMAIL THIS PAGE TO A FRIEND

CDKN2A

cyclin-dependent kinase inhibitor 2A

Synonyms: ARF CDK4I CDKN2 CMM2 INK4 INK4A MLM MTS-1 MTS1 P14 P14ARF P16 P16-INK4A P16INK4 P16INK4A P19 P19ARF TP16
Gene ID:
Human(1029) Summary: This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012]
Mouse(12578) cyclin-dependent kinase inhibitor 2A
Rat(25163) cyclin-dependent kinase inhibitor 2A
chicken(395077) cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)
dog(100271861) cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)
cow(616369) cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)
domestic cat(101089220) cyclin-dependent kinase inhibitor 2A
domestic guinea pig(100731972) cyclin-dependent kinase inhibitor 2A
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500221 Anti-CDKN2A (Isoform 1)/P16INK4A antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
GW21185 Anti-CDKN2A antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, mouse, human
western blot pricing
SAB2502016 Anti-Cdkn2a antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat
ELISA, western blot pricing
SAB2501929 Anti-CDKN2A antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA047838 Anti-CDKN2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1305897 ANTI-HP16-INK4A (N-TERM S7) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1306477 ANTI-MLM(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB4500073 Anti-p14 ARF antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4500072 Anti-p16 INK, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB1306566 ANTI-P16INK4A (C-TERM E119) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504720 Anti-phospho-p16-INK4a (pSer152) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB1306305 ANTI-PHOSPHO-P16-INK4A(S140) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306306 ANTI-PHOSPHO-P16-INK4A(S152) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306307 ANTI-PHOSPHO-P16-INK4A(S7) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB5300498 Monoclonal Anti-CDKN2A antibody produced in mouse clone 1E12E10, ascites fluid human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB5300499 Monoclonal Anti-CDKN2A antibody produced in mouse clone 5A8A4, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
P2610 Monoclonal Anti-p14ARF antibody produced in mouse ~2 mg/mL, clone DCS-240, purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, microarray, western blot pricing
SAB3300036 Monoclonal Anti-P16 antibody produced in mouse clone 4C11, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, western blot pricing
PLA0178 Rabbit anti-p16INK4a Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunoprecipitation, proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
R7772 Roscovitine ≥98% (TLC) human, mouse, rat pricing
O0886 Olomoucine ≥98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058197 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000077 Rosetta Predictions human pricing
NM_058195 Rosetta Predictions human pricing
NM_058197 Rosetta Predictions human pricing
NM_031550 Rosetta Predictions rat pricing
NM_001040654 Rosetta Predictions mouse pricing
NM_009877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015817 predicted 651
2 SASI_Hs01_00015818 predicted 633
3 SASI_Hs01_00015819 predicted 567
4 SASI_Hs01_00015820 predicted 573
5 SASI_Hs01_00015821 predicted 637
6 SASI_Hs01_00015822 predicted 626
7 SASI_Hs01_00015823 predicted 622
8 SASI_Hs01_00015824 predicted 643
9 SASI_Hs01_00015825 predicted 625
10 SASI_Hs01_00015826 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075722 predicted 642
2 SASI_Hs01_00075723 predicted 631
3 SASI_Hs01_00075724 predicted 555
4 SASI_Hs01_00075725 predicted 564
5 SASI_Hs01_00075726 predicted 629
6 SASI_Hs01_00075727 predicted 611
7 SASI_Hs01_00075728 predicted 615
8 SASI_Hs01_00075729 predicted 633
9 SASI_Hs01_00075730 predicted 618
10 SASI_Hs01_00075731 predicted 144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156567 predicted 923
2 SASI_Hs01_00156568 predicted 909
3 SASI_Hs01_00156569 predicted 842
4 SASI_Hs01_00156570 predicted 853
5 SASI_Hs01_00156571 predicted 905
6 SASI_Hs01_00156572 predicted 901
7 SASI_Hs01_00156573 predicted 891
8 SASI_Hs01_00156574 predicted 924
9 SASI_Hs01_00156575 predicted 896
10 SASI_Hs01_00156576 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114529 predicted 449
2 SASI_Rn01_00114530 predicted 277
3 SASI_Rn01_00114531 predicted 401
4 SASI_Rn01_00114532 predicted 393
5 SASI_Rn01_00114533 predicted 289
6 SASI_Rn02_00264737 predicted 195
7 SASI_Rn01_00114534 predicted 283
8 SASI_Rn01_00114535 predicted 353
9 SASI_Rn01_00114536 predicted 425
10 SASI_Rn01_00114537 predicted 449
11 SASI_Rn01_00114538 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039394 predicted 446
2 SASI_Mm01_00039395 predicted 420
3 SASI_Mm01_00039396 predicted 420
4 SASI_Mm01_00039397 predicted 443
5 SASI_Mm01_00039398 predicted 459
6 SASI_Mm01_00039399 predicted 474
7 SASI_Mm01_00039400 predicted 444
8 SASI_Mm01_00039401 predicted 468
9 SASI_Mm01_00039402 predicted 434
10 SASI_Mm01_00039403 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191680 predicted 521
2 SASI_Mm01_00191681 predicted 498
3 SASI_Mm01_00191682 predicted 504
4 SASI_Mm01_00191683 predicted 521
5 SASI_Mm01_00191684 predicted 537
6 SASI_Mm01_00191685 predicted 544
7 SASI_Mm01_00191686 predicted 526
8 SASI_Mm01_00191687 predicted 542
9 SASI_Mm01_00191688 predicted 508
10 SASI_Mm01_00191689 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058197
VALIDATED
CDKN2A MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 2A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058197.1-1335s1c1
Sequence:CCGGCGCACATTCATGTGGGCATTTCTCGAGAAATGCCCACATGAATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058197.1-401s1c1
Sequence:CCGGGCGCTGCCCAACGCACCGAATCTCGAGATTCGGTGCGTTGGGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058197.x-1329s1c1
Sequence:CCGGCCCTAAGCGCACATTCATGTCTCGAGACATGAATGTGCGCTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058197.3-573s21c1
Sequence:CCGGCGCGTACAGATCTCTCGAATGCTCGAGCATTCGAGAGATCTGTACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-950s21c1
Sequence:CCGGCCGATTGAAAGAACCAGAGAGCTCGAGCTCTCTGGTTCTTTCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-1129s21c1
Sequence:CCGGCACTACCGTAAATGTCCATTTCTCGAGAAATGGACATTTACGGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058197.3-612s21c1
Sequence:CCGGGGGAACATATTTGTATTAGATCTCGAGATCTAATACAAATATGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058197.3-588s21c1
Sequence:CCGGCGAATGCTGAGAAGATCTGAACTCGAGTTCAGATCTTCTCAGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-1000s21c1
Sequence:CCGGATCAGTCACCGAAGGTCCTACCTCGAGGTAGGACCTTCGGTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-971s21c1
Sequence:CCGGGCTCTGAGAAACCTCGGGAAACTCGAGTTTCCCGAGGTTTCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-982s21c1
Sequence:CCGGCCTCGGGAAACTTAGATCATCCTCGAGGATGATCTAAGTTTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058197
VALIDATED
CDKN2A MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 2A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058197.1-1335s1c1
Sequence:CCGGCGCACATTCATGTGGGCATTTCTCGAGAAATGCCCACATGAATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058197.1-401s1c1
Sequence:CCGGGCGCTGCCCAACGCACCGAATCTCGAGATTCGGTGCGTTGGGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058197.x-1329s1c1
Sequence:CCGGCCCTAAGCGCACATTCATGTCTCGAGACATGAATGTGCGCTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058197.3-573s21c1
Sequence:CCGGCGCGTACAGATCTCTCGAATGCTCGAGCATTCGAGAGATCTGTACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-950s21c1
Sequence:CCGGCCGATTGAAAGAACCAGAGAGCTCGAGCTCTCTGGTTCTTTCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-1129s21c1
Sequence:CCGGCACTACCGTAAATGTCCATTTCTCGAGAAATGGACATTTACGGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058197.3-612s21c1
Sequence:CCGGGGGAACATATTTGTATTAGATCTCGAGATCTAATACAAATATGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058197.3-588s21c1
Sequence:CCGGCGAATGCTGAGAAGATCTGAACTCGAGTTCAGATCTTCTCAGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-1000s21c1
Sequence:CCGGATCAGTCACCGAAGGTCCTACCTCGAGGTAGGACCTTCGGTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-971s21c1
Sequence:CCGGGCTCTGAGAAACCTCGGGAAACTCGAGTTTCCCGAGGTTTCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-982s21c1
Sequence:CCGGCCTCGGGAAACTTAGATCATCCTCGAGGATGATCTAAGTTTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058197
VALIDATED
CDKN2A MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 2A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058197.1-1335s1c1
Sequence:CCGGCGCACATTCATGTGGGCATTTCTCGAGAAATGCCCACATGAATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058197.1-401s1c1
Sequence:CCGGGCGCTGCCCAACGCACCGAATCTCGAGATTCGGTGCGTTGGGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058197.x-1329s1c1
Sequence:CCGGCCCTAAGCGCACATTCATGTCTCGAGACATGAATGTGCGCTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058197.3-573s21c1
Sequence:CCGGCGCGTACAGATCTCTCGAATGCTCGAGCATTCGAGAGATCTGTACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-950s21c1
Sequence:CCGGCCGATTGAAAGAACCAGAGAGCTCGAGCTCTCTGGTTCTTTCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-1129s21c1
Sequence:CCGGCACTACCGTAAATGTCCATTTCTCGAGAAATGGACATTTACGGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058197.3-612s21c1
Sequence:CCGGGGGAACATATTTGTATTAGATCTCGAGATCTAATACAAATATGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058197.3-588s21c1
Sequence:CCGGCGAATGCTGAGAAGATCTGAACTCGAGTTCAGATCTTCTCAGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-1000s21c1
Sequence:CCGGATCAGTCACCGAAGGTCCTACCTCGAGGTAGGACCTTCGGTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-971s21c1
Sequence:CCGGGCTCTGAGAAACCTCGGGAAACTCGAGTTTCCCGAGGTTTCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_058197.3-982s21c1
Sequence:CCGGCCTCGGGAAACTTAGATCATCCTCGAGGATGATCTAAGTTTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009877
CDKN2A MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 2A
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009877.1-169s1c1
Sequence:CCGGGTGAACATGTTGTTGAGGCTACTCGAGTAGCCTCAACAACATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009877.1-508s1c1
Sequence:CCGGGTCTTTGTGTACCGCTGGGAACTCGAGTTCCCAGCGGTACACAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-164s21c1
Sequence:CCGGTCTTGGTGAAGTTCGTGCGATCTCGAGATCGCACGAACTTCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-597s21c1
Sequence:CCGGACGGGCATAGCTTCAGCTCAACTCGAGTTGAGCTGAAGCTATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009877.2-707s21c1
Sequence:CCGGCTAGCGATGCTAGCGTGTCTACTCGAGTAGACACGCTAGCATCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-289s21c1
Sequence:CCGGGATGATGATGGGCAACGTTCACTCGAGTGAACGTTGCCCATCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009877.1-449s1c2
Sequence:CCGGCATCAAGACATCGTGCGATATCTCGAGATATCGCACGATGTCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009877.1-233s1c2
Sequence:CCGGGTGATGATGATGGGCAACGTTCTCGAGAACGTTGCCCATCATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009877.2-650s21c1
Sequence:CCGGTCCCAAGAGCAGAGCTAAATCCTCGAGGATTTAGCTCTGCTCTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-505s21c1
Sequence:CCGGTCAAGACATCGTGCGATATTTCTCGAGAAATATCGCACGATGTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-325s21c1
Sequence:CCGGGCTCAACTACGGTGCAGATTCCTCGAGGAATCTGCACCGTAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-235s21c1
Sequence:CCGGTTGAGGCTAGAGAGGATCTTGCTCGAGCAAGATCCTCTCTAGCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-210s21c1
Sequence:CCGGCGCTCTGGCTTTCGTGAACATCTCGAGATGTTCACGAAAGCCAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009877
CDKN2A MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 2A
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009877.1-169s1c1
Sequence:CCGGGTGAACATGTTGTTGAGGCTACTCGAGTAGCCTCAACAACATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009877.1-508s1c1
Sequence:CCGGGTCTTTGTGTACCGCTGGGAACTCGAGTTCCCAGCGGTACACAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-164s21c1
Sequence:CCGGTCTTGGTGAAGTTCGTGCGATCTCGAGATCGCACGAACTTCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-597s21c1
Sequence:CCGGACGGGCATAGCTTCAGCTCAACTCGAGTTGAGCTGAAGCTATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009877.2-707s21c1
Sequence:CCGGCTAGCGATGCTAGCGTGTCTACTCGAGTAGACACGCTAGCATCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-289s21c1
Sequence:CCGGGATGATGATGGGCAACGTTCACTCGAGTGAACGTTGCCCATCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009877.1-449s1c2
Sequence:CCGGCATCAAGACATCGTGCGATATCTCGAGATATCGCACGATGTCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009877.1-233s1c2
Sequence:CCGGGTGATGATGATGGGCAACGTTCTCGAGAACGTTGCCCATCATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009877.2-650s21c1
Sequence:CCGGTCCCAAGAGCAGAGCTAAATCCTCGAGGATTTAGCTCTGCTCTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-505s21c1
Sequence:CCGGTCAAGACATCGTGCGATATTTCTCGAGAAATATCGCACGATGTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-325s21c1
Sequence:CCGGGCTCAACTACGGTGCAGATTCCTCGAGGAATCTGCACCGTAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-235s21c1
Sequence:CCGGTTGAGGCTAGAGAGGATCTTGCTCGAGCAAGATCCTCTCTAGCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-210s21c1
Sequence:CCGGCGCTCTGGCTTTCGTGAACATCTCGAGATGTTCACGAAAGCCAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009877
CDKN2A MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 2A
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009877.1-169s1c1
Sequence:CCGGGTGAACATGTTGTTGAGGCTACTCGAGTAGCCTCAACAACATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009877.1-508s1c1
Sequence:CCGGGTCTTTGTGTACCGCTGGGAACTCGAGTTCCCAGCGGTACACAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-164s21c1
Sequence:CCGGTCTTGGTGAAGTTCGTGCGATCTCGAGATCGCACGAACTTCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-597s21c1
Sequence:CCGGACGGGCATAGCTTCAGCTCAACTCGAGTTGAGCTGAAGCTATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009877.2-707s21c1
Sequence:CCGGCTAGCGATGCTAGCGTGTCTACTCGAGTAGACACGCTAGCATCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-289s21c1
Sequence:CCGGGATGATGATGGGCAACGTTCACTCGAGTGAACGTTGCCCATCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009877.1-449s1c2
Sequence:CCGGCATCAAGACATCGTGCGATATCTCGAGATATCGCACGATGTCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009877.1-233s1c2
Sequence:CCGGGTGATGATGATGGGCAACGTTCTCGAGAACGTTGCCCATCATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009877.2-650s21c1
Sequence:CCGGTCCCAAGAGCAGAGCTAAATCCTCGAGGATTTAGCTCTGCTCTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-505s21c1
Sequence:CCGGTCAAGACATCGTGCGATATTTCTCGAGAAATATCGCACGATGTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-325s21c1
Sequence:CCGGGCTCAACTACGGTGCAGATTCCTCGAGGAATCTGCACCGTAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-235s21c1
Sequence:CCGGTTGAGGCTAGAGAGGATCTTGCTCGAGCAAGATCCTCTCTAGCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009877.2-210s21c1
Sequence:CCGGCGCTCTGGCTTTCGTGAACATCTCGAGATGTTCACGAAAGCCAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks