EMAIL THIS PAGE TO A FRIEND

CDKN2AIP

CDKN2A interacting protein

107 Gene Product Result for
Synonyms: CARF
UniProtKB ID: Q9NXV6, Q8TBM5, Q9NYH0
Gene ID:
Mouse(70925) CDKN2A interacting protein
Rat(306455) CDKN2A interacting protein
domestic guinea pig(100722347) CDKN2A interacting protein
naked mole-rat(101697262) CDKN2A interacting protein
sheep(101108190) CDKN2A interacting protein
chicken(769372) CDKN2A interacting protein
cow(513265) CDKN2A interacting protein
domestic cat(101095334) CDKN2A interacting protein
dog(607991) CDKN2A interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40869 Anti-CARF antibody produced in rabbit IgG fraction of antiserum rabbit, canine, horse, human, guinea pig, mouse, rat
immunohistochemistry, western blot pricing
SAB1409503 Anti-CDKN2AIP antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
HPA041397 Anti-CDKN2AIP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1411061 Anti-CDKN2AIP antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA062142 Anti-CDKN2AIP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2104558 Anti-CDKN2AIP, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, human, mouse, rabbit
western blot pricing
WH0055602M2 Monoclonal Anti-CARF antibody produced in mouse clone 1A6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1405154 Monoclonal Anti-CARF antibody produced in mouse clone 2E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409500 Monoclonal Anti-CDKN2AIP antibody produced in mouse clone 4D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation, western blot pricing
SAB1409501 Monoclonal Anti-CDKN2AIP antibody produced in mouse clone 1E10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409502 Monoclonal Anti-CDKN2AIP antibody produced in mouse clone 1F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017632 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017632 Rosetta Predictions human pricing
NM_001014000 Rosetta Predictions rat pricing
NM_172407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166807 predicted 1800
2 SASI_Hs01_00166808 predicted 1914
3 SASI_Hs01_00166809 predicted 1167
4 SASI_Hs01_00166810 predicted 509
5 SASI_Hs01_00166811 predicted 1101
6 SASI_Hs01_00166812 predicted 1407
7 SASI_Hs02_00350311 predicted 1418
8 SASI_Hs01_00166813 predicted 546
9 SASI_Hs02_00350312 predicted 1918
10 SASI_Hs01_00166816 predicted 608
11 SASI_Hs01_00166814 predicted 1504
12 SASI_Hs01_00166815 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072216 predicted 966
2 SASI_Rn01_00072218 predicted 639
3 SASI_Rn01_00072219 predicted 980
4 SASI_Rn01_00072220 predicted 1886
5 SASI_Rn01_00072221 predicted 1816
6 SASI_Rn01_00072222 predicted 706
7 SASI_Rn01_00072223 predicted 1112
8 SASI_Rn01_00072224 predicted 1794
9 SASI_Rn01_00072225 predicted 1998
10 SASI_Rn02_00201364 predicted 1176
11 SASI_Rn01_00072217 predicted 1832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095411 predicted 1388
2 SASI_Mm01_00095412 predicted 758
3 SASI_Mm01_00095413 predicted 1789
4 SASI_Mm01_00095414 predicted 1839
5 SASI_Mm01_00095416 predicted 1789
6 SASI_Mm01_00095417 predicted 1484
7 SASI_Mm01_00095418 predicted 1020
8 SASI_Mm02_00343870 predicted 1666
9 SASI_Mm01_00095419 predicted 1781
10 SASI_Mm01_00095420 predicted 1826
11 SASI_Mm01_00095415 predicted 1386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172407
CDKN2AIP MISSION shRNA Bacterial Glycerol Stock
CDKN2A interacting protein
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172407.3-1380s21c1
Sequence:CCGGGCTTGTCGGAAGTTAACCAATCTCGAGATTGGTTAACTTCCGACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172407.3-2146s21c1
Sequence:CCGGTTGTACTACTACTACCAATTTCTCGAGAAATTGGTAGTAGTAGTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172407.3-445s21c1
Sequence:CCGGGTATGGCTGAAGGCATCAAAGCTCGAGCTTTGATGCCTTCAGCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172407.3-1624s21c1
Sequence:CCGGTGAGGTGTAAGTCGGTATATTCTCGAGAATATACCGACTTACACCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172407.3-1358s21c1
Sequence:CCGGCAGTGAGAGTTCTGTCAAGTTCTCGAGAACTTGACAGAACTCTCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172407.1-1059s1c1
Sequence:CCGGCCAGTGGGTTAACATCTAAATCTCGAGATTTAGATGTTAACCCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172407.1-2936s1c1
Sequence:CCGGCTGGACAATAATGGAGATAATCTCGAGATTATCTCCATTATTGTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172407.1-1662s1c1
Sequence:CCGGCGAGAGAAGCACTGAAGTTATCTCGAGATAACTTCAGTGCTTCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172407.1-1349s1c1
Sequence:CCGGGCTTGTCGGAAGTTAACCAATCTCGAGATTGGTTAACTTCCGACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172407.1-1327s1c1
Sequence:CCGGCAGTGAGAGTTCTGTCAAGTTCTCGAGAACTTGACAGAACTCTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172407.1-2084s1c1
Sequence:CCGGCGATGTGTAGTTCTGTAGAATCTCGAGATTCTACAGAACTACACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172407.1-1571s1c1
Sequence:CCGGCAAGAAAGTATTGTCTGTGAACTCGAGTTCACAGACAATACTTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172407
CDKN2AIP MISSION shRNA shRNA Plasmid DNA
CDKN2A interacting protein
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172407.3-1380s21c1
Sequence:CCGGGCTTGTCGGAAGTTAACCAATCTCGAGATTGGTTAACTTCCGACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172407.3-2146s21c1
Sequence:CCGGTTGTACTACTACTACCAATTTCTCGAGAAATTGGTAGTAGTAGTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172407.3-445s21c1
Sequence:CCGGGTATGGCTGAAGGCATCAAAGCTCGAGCTTTGATGCCTTCAGCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172407.3-1624s21c1
Sequence:CCGGTGAGGTGTAAGTCGGTATATTCTCGAGAATATACCGACTTACACCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172407.3-1358s21c1
Sequence:CCGGCAGTGAGAGTTCTGTCAAGTTCTCGAGAACTTGACAGAACTCTCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172407.1-1059s1c1
Sequence:CCGGCCAGTGGGTTAACATCTAAATCTCGAGATTTAGATGTTAACCCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172407.1-2936s1c1
Sequence:CCGGCTGGACAATAATGGAGATAATCTCGAGATTATCTCCATTATTGTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172407.1-1662s1c1
Sequence:CCGGCGAGAGAAGCACTGAAGTTATCTCGAGATAACTTCAGTGCTTCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172407.1-1349s1c1
Sequence:CCGGGCTTGTCGGAAGTTAACCAATCTCGAGATTGGTTAACTTCCGACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172407.1-1327s1c1
Sequence:CCGGCAGTGAGAGTTCTGTCAAGTTCTCGAGAACTTGACAGAACTCTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172407.1-2084s1c1
Sequence:CCGGCGATGTGTAGTTCTGTAGAATCTCGAGATTCTACAGAACTACACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172407.1-1571s1c1
Sequence:CCGGCAAGAAAGTATTGTCTGTGAACTCGAGTTCACAGACAATACTTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172407
CDKN2AIP MISSION shRNA Lentiviral Transduction Particles
CDKN2A interacting protein
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172407.3-1380s21c1
Sequence:CCGGGCTTGTCGGAAGTTAACCAATCTCGAGATTGGTTAACTTCCGACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172407.3-2146s21c1
Sequence:CCGGTTGTACTACTACTACCAATTTCTCGAGAAATTGGTAGTAGTAGTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172407.3-445s21c1
Sequence:CCGGGTATGGCTGAAGGCATCAAAGCTCGAGCTTTGATGCCTTCAGCCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172407.3-1624s21c1
Sequence:CCGGTGAGGTGTAAGTCGGTATATTCTCGAGAATATACCGACTTACACCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172407.3-1358s21c1
Sequence:CCGGCAGTGAGAGTTCTGTCAAGTTCTCGAGAACTTGACAGAACTCTCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172407.1-1059s1c1
Sequence:CCGGCCAGTGGGTTAACATCTAAATCTCGAGATTTAGATGTTAACCCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172407.1-2936s1c1
Sequence:CCGGCTGGACAATAATGGAGATAATCTCGAGATTATCTCCATTATTGTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172407.1-1662s1c1
Sequence:CCGGCGAGAGAAGCACTGAAGTTATCTCGAGATAACTTCAGTGCTTCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172407.1-1349s1c1
Sequence:CCGGGCTTGTCGGAAGTTAACCAATCTCGAGATTGGTTAACTTCCGACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172407.1-1327s1c1
Sequence:CCGGCAGTGAGAGTTCTGTCAAGTTCTCGAGAACTTGACAGAACTCTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172407.1-2084s1c1
Sequence:CCGGCGATGTGTAGTTCTGTAGAATCTCGAGATTCTACAGAACTACACATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172407.1-1571s1c1
Sequence:CCGGCAAGAAAGTATTGTCTGTGAACTCGAGTTCACAGACAATACTTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017632
CDKN2AIP MISSION shRNA Bacterial Glycerol Stock
CDKN2A interacting protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017632.1-620s1c1
Sequence:CCGGCAGTTGAGCAAGATCACGCAACTCGAGTTGCGTGATCTTGCTCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017632.1-1858s1c1
Sequence:CCGGCCTGTAAACTTACCTCCAGCACTCGAGTGCTGGAGGTAAGTTTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017632.1-812s1c1
Sequence:CCGGGCGTTTCCTCTCAGGTAACAACTCGAGTTGTTACCTGAGAGGAAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017632.1-1217s1c1
Sequence:CCGGCAACAAATACATCGCTGCTAACTCGAGTTAGCAGCGATGTATTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017632.1-1073s1c1
Sequence:CCGGCACTATTGTCTTCCAAACCTACTCGAGTAGGTTTGGAAGACAATAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017632.1-1584s1c1
Sequence:CCGGGAAAGCAACACTGGATGTATTCTCGAGAATACATCCAGTGTTGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017632.1-1825s1c1
Sequence:CCGGGAAGATCTAGTACTCCTTGATCTCGAGATCAAGGAGTACTAGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017632.1-1677s1c1
Sequence:CCGGGAGGTGCAAGTCTGTGTATTTCTCGAGAAATACACAGACTTGCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017632.1-2043s1c1
Sequence:CCGGCTTCACACAGTAGCAGTTGTACTCGAGTACAACTGCTACTGTGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017632
CDKN2AIP MISSION shRNA shRNA Plasmid DNA
CDKN2A interacting protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017632.1-620s1c1
Sequence:CCGGCAGTTGAGCAAGATCACGCAACTCGAGTTGCGTGATCTTGCTCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017632.1-1858s1c1
Sequence:CCGGCCTGTAAACTTACCTCCAGCACTCGAGTGCTGGAGGTAAGTTTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017632.1-812s1c1
Sequence:CCGGGCGTTTCCTCTCAGGTAACAACTCGAGTTGTTACCTGAGAGGAAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017632.1-1217s1c1
Sequence:CCGGCAACAAATACATCGCTGCTAACTCGAGTTAGCAGCGATGTATTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017632.1-1073s1c1
Sequence:CCGGCACTATTGTCTTCCAAACCTACTCGAGTAGGTTTGGAAGACAATAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017632.1-1584s1c1
Sequence:CCGGGAAAGCAACACTGGATGTATTCTCGAGAATACATCCAGTGTTGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017632.1-1825s1c1
Sequence:CCGGGAAGATCTAGTACTCCTTGATCTCGAGATCAAGGAGTACTAGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017632.1-1677s1c1
Sequence:CCGGGAGGTGCAAGTCTGTGTATTTCTCGAGAAATACACAGACTTGCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017632.1-2043s1c1
Sequence:CCGGCTTCACACAGTAGCAGTTGTACTCGAGTACAACTGCTACTGTGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017632
CDKN2AIP MISSION shRNA Lentiviral Transduction Particles
CDKN2A interacting protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017632.1-620s1c1
Sequence:CCGGCAGTTGAGCAAGATCACGCAACTCGAGTTGCGTGATCTTGCTCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017632.1-1858s1c1
Sequence:CCGGCCTGTAAACTTACCTCCAGCACTCGAGTGCTGGAGGTAAGTTTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017632.1-812s1c1
Sequence:CCGGGCGTTTCCTCTCAGGTAACAACTCGAGTTGTTACCTGAGAGGAAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017632.1-1217s1c1
Sequence:CCGGCAACAAATACATCGCTGCTAACTCGAGTTAGCAGCGATGTATTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017632.1-1073s1c1
Sequence:CCGGCACTATTGTCTTCCAAACCTACTCGAGTAGGTTTGGAAGACAATAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017632.1-1584s1c1
Sequence:CCGGGAAAGCAACACTGGATGTATTCTCGAGAATACATCCAGTGTTGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017632.1-1825s1c1
Sequence:CCGGGAAGATCTAGTACTCCTTGATCTCGAGATCAAGGAGTACTAGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017632.1-1677s1c1
Sequence:CCGGGAGGTGCAAGTCTGTGTATTTCTCGAGAAATACACAGACTTGCACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017632.1-2043s1c1
Sequence:CCGGCTTCACACAGTAGCAGTTGTACTCGAGTACAACTGCTACTGTGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)