EMAIL THIS PAGE TO A FRIEND

CDKN2AIPNL

CDKN2A interacting protein N-terminal like

81 Gene Product Result for
UniProtKB ID: Q96HQ2, Q8WVE3
Gene ID:
Mouse(52626) CDKN2A interacting protein N-terminal like
Rat(287278) CDKN2A interacting protein N-terminal like
Zebrafish(450034) CDKN2A interacting protein N-terminal like
cow(512206) CDKN2A interacting protein N-terminal like
domestic cat(101099927) CDKN2A interacting protein N-terminal like
dog(481507) CDKN2A interacting protein N-terminal like
sheep(100135688) CDKN2A interacting protein N-terminal like
naked mole-rat(101705444) CDKN2A interacting protein N-terminal like
domestic guinea pig(100713621) CDKN2A interacting protein N-terminal like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080656 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU052621 MISSION® esiRNA esiRNA targeting mouse Cdkn2aipnl (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080656 Rosetta Predictions human pricing
NM_001008278 Rosetta Predictions rat pricing
NM_029976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362407 predicted 260
2 SASI_Hs02_00362408 predicted 266
3 SASI_Hs02_00362409 predicted 357
4 SASI_Hs02_00362410 predicted 397
5 SASI_Hs02_00362411 predicted 343
6 SASI_Hs01_00053750 predicted 320
7 SASI_Hs02_00362412 predicted 270
8 SASI_Hs02_00362413 predicted 346
9 SASI_Hs02_00362414 predicted 272
10 SASI_Hs02_00362415 predicted 334
11 SASI_Hs01_00053751 predicted 252
12 SASI_Hs01_00053752 predicted 232
13 SASI_Hs01_00053753 predicted 139
14 SASI_Hs01_00053754 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039303 predicted 319
2 SASI_Rn01_00039304 predicted 244
3 SASI_Rn02_00198976 predicted 397
4 SASI_Rn01_00039305 predicted 815
5 SASI_Rn01_00039306 predicted 762
6 SASI_Rn01_00039307 predicted 805
7 SASI_Rn01_00039308 predicted 565
8 SASI_Rn01_00039309 predicted 110
9 SASI_Rn01_00039310 predicted 507
10 SASI_Rn01_00039311 predicted 744
11 SASI_Rn01_00039312 predicted 88
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129806 predicted 782
2 SASI_Mm01_00129807 predicted 619
3 SASI_Mm01_00129808 predicted 373
4 SASI_Mm01_00129809 predicted 304
5 SASI_Mm01_00129811 predicted 387
6 SASI_Mm01_00129812 predicted 283
7 SASI_Mm01_00129813 predicted 384
8 SASI_Mm01_00129814 predicted 368
9 SASI_Mm01_00129815 predicted 454
10 SASI_Mm02_00336308 predicted 627
11 SASI_Mm01_00129810 predicted 655
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080656
VALIDATED
CDKN2AIPNL MISSION shRNA Bacterial Glycerol Stock
CDKN2A interacting protein N-terminal like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080656.1-930s1c1
Sequence:CCGGCCATAATAATCCCAGCACTTTCTCGAGAAAGTGCTGGGATTATTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080656.1-349s1c1
Sequence:CCGGCACAATTTACTACCAGAAGTGCTCGAGCACTTCTGGTAGTAAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080656.1-280s1c1
Sequence:CCGGGCAGTTACAATAAAGACCTTTCTCGAGAAAGGTCTTTATTGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080656.1-358s1c1
Sequence:CCGGCTACCAGAAGTGAATTAATGACTCGAGTCATTAATTCACTTCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080656.1-396s1c1
Sequence:CCGGGCCAGAAGATTTATCACATTTCTCGAGAAATGTGATAAATCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080656.1-568s1c1
Sequence:CCGGCCCAGGAGTTATCACTGTAAACTCGAGTTTACAGTGATAACTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080656.1-272s1c1
Sequence:CCGGCCTAGGCTGCAGTTACAATAACTCGAGTTATTGTAACTGCAGCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080656.2-534s21c1
Sequence:CCGGAGAAGGACTCTGTCTAGATTGCTCGAGCAATCTAGACAGAGTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080656.2-731s21c1
Sequence:CCGGGAAGCACAAAGGTGCAGTATTCTCGAGAATACTGCACCTTTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080656
VALIDATED
CDKN2AIPNL MISSION shRNA shRNA Plasmid DNA
CDKN2A interacting protein N-terminal like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080656.1-930s1c1
Sequence:CCGGCCATAATAATCCCAGCACTTTCTCGAGAAAGTGCTGGGATTATTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080656.1-349s1c1
Sequence:CCGGCACAATTTACTACCAGAAGTGCTCGAGCACTTCTGGTAGTAAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080656.1-280s1c1
Sequence:CCGGGCAGTTACAATAAAGACCTTTCTCGAGAAAGGTCTTTATTGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080656.1-358s1c1
Sequence:CCGGCTACCAGAAGTGAATTAATGACTCGAGTCATTAATTCACTTCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080656.1-396s1c1
Sequence:CCGGGCCAGAAGATTTATCACATTTCTCGAGAAATGTGATAAATCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080656.1-568s1c1
Sequence:CCGGCCCAGGAGTTATCACTGTAAACTCGAGTTTACAGTGATAACTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080656.1-272s1c1
Sequence:CCGGCCTAGGCTGCAGTTACAATAACTCGAGTTATTGTAACTGCAGCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080656.2-534s21c1
Sequence:CCGGAGAAGGACTCTGTCTAGATTGCTCGAGCAATCTAGACAGAGTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080656.2-731s21c1
Sequence:CCGGGAAGCACAAAGGTGCAGTATTCTCGAGAATACTGCACCTTTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080656
VALIDATED
CDKN2AIPNL MISSION shRNA Lentiviral Transduction Particles
CDKN2A interacting protein N-terminal like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080656.1-930s1c1
Sequence:CCGGCCATAATAATCCCAGCACTTTCTCGAGAAAGTGCTGGGATTATTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080656.1-349s1c1
Sequence:CCGGCACAATTTACTACCAGAAGTGCTCGAGCACTTCTGGTAGTAAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080656.1-280s1c1
Sequence:CCGGGCAGTTACAATAAAGACCTTTCTCGAGAAAGGTCTTTATTGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080656.1-358s1c1
Sequence:CCGGCTACCAGAAGTGAATTAATGACTCGAGTCATTAATTCACTTCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080656.1-396s1c1
Sequence:CCGGGCCAGAAGATTTATCACATTTCTCGAGAAATGTGATAAATCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080656.1-568s1c1
Sequence:CCGGCCCAGGAGTTATCACTGTAAACTCGAGTTTACAGTGATAACTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080656.1-272s1c1
Sequence:CCGGCCTAGGCTGCAGTTACAATAACTCGAGTTATTGTAACTGCAGCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080656.2-534s21c1
Sequence:CCGGAGAAGGACTCTGTCTAGATTGCTCGAGCAATCTAGACAGAGTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080656.2-731s21c1
Sequence:CCGGGAAGCACAAAGGTGCAGTATTCTCGAGAATACTGCACCTTTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029976
VALIDATED
CDKN2AIPNL MISSION shRNA Bacterial Glycerol Stock
CDKN2A interacting protein N-terminal like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029976.2-796s21c1
Sequence:CCGGGATCCTCTGTGTCCTTATTTCCTCGAGGAAATAAGGACACAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029976.2-405s21c1
Sequence:CCGGTAAGGCAGATCTCCACATTTCCTCGAGGAAATGTGGAGATCTGCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029976.2-238s21c1
Sequence:CCGGTGGACCAGCTGCTGTCCTTATCTCGAGATAAGGACAGCAGCTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029976.2-282s21c1
Sequence:CCGGTTCCTGGGTTGCAGTTATAATCTCGAGATTATAACTGCAACCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029976.2-368s21c1
Sequence:CCGGTACAACCAGAAGCGAACTAATCTCGAGATTAGTTCGCTTCTGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029976
VALIDATED
CDKN2AIPNL MISSION shRNA shRNA Plasmid DNA
CDKN2A interacting protein N-terminal like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029976.2-796s21c1
Sequence:CCGGGATCCTCTGTGTCCTTATTTCCTCGAGGAAATAAGGACACAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029976.2-405s21c1
Sequence:CCGGTAAGGCAGATCTCCACATTTCCTCGAGGAAATGTGGAGATCTGCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029976.2-238s21c1
Sequence:CCGGTGGACCAGCTGCTGTCCTTATCTCGAGATAAGGACAGCAGCTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029976.2-282s21c1
Sequence:CCGGTTCCTGGGTTGCAGTTATAATCTCGAGATTATAACTGCAACCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029976.2-368s21c1
Sequence:CCGGTACAACCAGAAGCGAACTAATCTCGAGATTAGTTCGCTTCTGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029976
VALIDATED
CDKN2AIPNL MISSION shRNA Lentiviral Transduction Particles
CDKN2A interacting protein N-terminal like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029976.2-796s21c1
Sequence:CCGGGATCCTCTGTGTCCTTATTTCCTCGAGGAAATAAGGACACAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029976.2-405s21c1
Sequence:CCGGTAAGGCAGATCTCCACATTTCCTCGAGGAAATGTGGAGATCTGCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029976.2-238s21c1
Sequence:CCGGTGGACCAGCTGCTGTCCTTATCTCGAGATAAGGACAGCAGCTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029976.2-282s21c1
Sequence:CCGGTTCCTGGGTTGCAGTTATAATCTCGAGATTATAACTGCAACCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029976.2-368s21c1
Sequence:CCGGTACAACCAGAAGCGAACTAATCTCGAGATTAGTTCGCTTCTGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks