EMAIL THIS PAGE TO A FRIEND

CDKN2B

cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)

Synonyms: CDK4I INK4B MTS2 P15 TP15 p15INK4b
UniProtKB ID: P42772, O15125, Q6FI09
Gene ID:
Human(1030) Summary: This gene lies adjacent to the tumor suppressor gene CDKN2A in a region that is frequently mutated and deleted in a wide variety of tumors. This gene encodes a cyclin-dependent kinase inhibitor, which forms a complex with CDK4 or CDK6, and prevents the activation of the CDK kinases, thus the encoded protein functions as a cell growth regulator that controls cell cycle G1 progression. The expression of this gene was found to be dramatically induced by TGF beta, which suggested its role in the TGF beta induced growth inhibition. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
Mouse(12579) cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
Rat(25164) cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
chicken(395076) cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
dog(481563) cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
Horse(100034122) cyclin-dependent kinase 2B inhibitor
cow(527124) cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
domestic cat(101087014) cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
domestic guinea pig(100732246) cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
sheep(101107164) cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
R7772 Roscovitine ≥98% (TLC) human, mouse, rat pricing
O0886 Olomoucine ≥98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_078487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_078487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_078487 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134441 MISSION® esiRNA esiRNA human CDKN2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004936 Rosetta Predictions human pricing
NM_078487 Rosetta Predictions human pricing
NM_130812 Rosetta Predictions rat pricing
NM_007670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213898 predicted 932
2 SASI_Hs01_00213899 predicted 1004
3 SASI_Hs01_00213900 predicted 1161
4 SASI_Hs01_00213901 predicted 925
5 SASI_Hs01_00213903 predicted 1216
6 SASI_Hs01_00213904 predicted 921
7 SASI_Hs01_00213905 predicted 1005
8 SASI_Hs02_00338606 predicted 879
9 SASI_Hs01_00213906 predicted 1105
10 SASI_Hs01_00213907 predicted 885
11 SASI_Hs01_00213902 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230281 predicted 1048
2 SASI_Hs01_00230282 predicted 1003
3 SASI_Hs01_00230283 predicted 3412
4 SASI_Hs01_00230284 predicted 3741
5 SASI_Hs01_00230286 predicted 3888
6 SASI_Hs01_00230287 predicted 1285
7 SASI_Hs02_00362171 predicted 2361
8 SASI_Hs01_00230288 predicted 1704
9 SASI_Hs01_00230289 predicted 2367
10 SASI_Hs01_00230290 predicted 1443
11 SASI_Hs01_00230285 predicted 3878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130812 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267496 predicted 762
2 SASI_Rn02_00267497 predicted 802
3 SASI_Rn02_00267498 predicted 471
4 SASI_Rn02_00267499 predicted 728
5 SASI_Rn02_00267500 predicted 764
6 SASI_Rn02_00267501 predicted 639
7 SASI_Rn02_00267502 predicted 565
8 SASI_Rn02_00267503 predicted 380
9 SASI_Rn02_00267504 predicted 752
10 SASI_Rn02_00267505 predicted 769
11 SASI_Rn01_00114747 predicted 281
12 SASI_Rn01_00114748 predicted 286
13 SASI_Rn01_00114749 predicted 282
14 SASI_Rn01_00114750 predicted 264
15 SASI_Rn01_00114751 predicted 282
16 SASI_Rn01_00114752 predicted 287
17 SASI_Rn01_00114753 predicted 361
18 SASI_Rn01_00114754 predicted 352
19 SASI_Rn01_00114755 predicted 258
20 SASI_Rn01_00114756 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144010 predicted 872
2 SASI_Mm01_00144011 predicted 768
3 SASI_Mm01_00144012 predicted 938
4 SASI_Mm01_00144013 predicted 281
5 SASI_Mm01_00144014 predicted 867
6 SASI_Mm02_00312179 predicted 662
7 SASI_Mm01_00144016 predicted 756
8 SASI_Mm01_00144017 predicted 956
9 SASI_Mm01_00144018 predicted 506
10 SASI_Mm01_00144019 predicted 691
11 SASI_Mm01_00144015 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007670
CDKN2B MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007670.4-585s21c1
Sequence:CCGGACCGTGACATTGCGAGGTATCCTCGAGGATACCTCGCAATGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007670.4-883s21c1
Sequence:CCGGCCTTTCAGGACGCGGTGTAAACTCGAGTTTACACCGCGTCCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007670.4-357s21c1
Sequence:CCGGGCCCAATCCAGGTCATGATGACTCGAGTCATCATGACCTGGATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007670.2-1068s1c1
Sequence:CCGGCGACAAGGAAATAGTGAAATTCTCGAGAATTTCACTATTTCCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007670.2-236s1c1
Sequence:CCGGCGCAGATCCCAACGCCCTGAACTCGAGTTCAGGGCGTTGGGATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007670.2-468s1c1
Sequence:CCGGCTGCCGGTAGACTTAGCTGAACTCGAGTTCAGCTAAGTCTACCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007670.2-269s1c1
Sequence:CCGGGCGCCCAATCCAGGTCATGATCTCGAGATCATGACCTGGATTGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007670.2-497s1c1
Sequence:CCGGCCACCGTGACATTGCGAGGTACTCGAGTACCTCGCAATGTCACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007670
CDKN2B MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007670.4-585s21c1
Sequence:CCGGACCGTGACATTGCGAGGTATCCTCGAGGATACCTCGCAATGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007670.4-883s21c1
Sequence:CCGGCCTTTCAGGACGCGGTGTAAACTCGAGTTTACACCGCGTCCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007670.4-357s21c1
Sequence:CCGGGCCCAATCCAGGTCATGATGACTCGAGTCATCATGACCTGGATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007670.2-1068s1c1
Sequence:CCGGCGACAAGGAAATAGTGAAATTCTCGAGAATTTCACTATTTCCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007670.2-236s1c1
Sequence:CCGGCGCAGATCCCAACGCCCTGAACTCGAGTTCAGGGCGTTGGGATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007670.2-468s1c1
Sequence:CCGGCTGCCGGTAGACTTAGCTGAACTCGAGTTCAGCTAAGTCTACCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007670.2-269s1c1
Sequence:CCGGGCGCCCAATCCAGGTCATGATCTCGAGATCATGACCTGGATTGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007670.2-497s1c1
Sequence:CCGGCCACCGTGACATTGCGAGGTACTCGAGTACCTCGCAATGTCACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007670
CDKN2B MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007670.4-585s21c1
Sequence:CCGGACCGTGACATTGCGAGGTATCCTCGAGGATACCTCGCAATGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007670.4-883s21c1
Sequence:CCGGCCTTTCAGGACGCGGTGTAAACTCGAGTTTACACCGCGTCCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007670.4-357s21c1
Sequence:CCGGGCCCAATCCAGGTCATGATGACTCGAGTCATCATGACCTGGATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007670.2-1068s1c1
Sequence:CCGGCGACAAGGAAATAGTGAAATTCTCGAGAATTTCACTATTTCCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007670.2-236s1c1
Sequence:CCGGCGCAGATCCCAACGCCCTGAACTCGAGTTCAGGGCGTTGGGATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007670.2-468s1c1
Sequence:CCGGCTGCCGGTAGACTTAGCTGAACTCGAGTTCAGCTAAGTCTACCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007670.2-269s1c1
Sequence:CCGGGCGCCCAATCCAGGTCATGATCTCGAGATCATGACCTGGATTGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007670.2-497s1c1
Sequence:CCGGCCACCGTGACATTGCGAGGTACTCGAGTACCTCGCAATGTCACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_078487
CDKN2B MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-2186s21c1
Sequence:CCGGCTCGTGGGATGTCCTACTATCCTCGAGGATAGTAGGACATCCCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3507s21c1
Sequence:CCGGCCTAATGACAACCTGATATTACTCGAGTAATATCAGGTTGTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3232s21c1
Sequence:CCGGCACTTAAGCACTCAATCATTACTCGAGTAATGATTGAGTGCTTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3737s21c1
Sequence:CCGGTTCATCAGCAGCCTAATATATCTCGAGATATATTAGGCTGCTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-2515s21c1
Sequence:CCGGTATGCTTCTAAATGCTCATTCCTCGAGGAATGAGCATTTAGAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3365s21c1
Sequence:CCGGCCCTTAATTTGACCTCTATATCTCGAGATATAGAGGTCAAATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-2322s21c1
Sequence:CCGGACTCCAAGAGGTGGGTAATTTCTCGAGAAATTACCCACCTCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-2246s21c1
Sequence:CCGGTCCAGGGTTGCTTGATCATTACTCGAGTAATGATCAAGCAACCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-1129s21c1
Sequence:CCGGAGCGGATTTCCAGGGATATTTCTCGAGAAATATCCCTGGAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3553s21c1
Sequence:CCGGTGGATCCCACAGTACTATATTCTCGAGAATATAGTACTGTGGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078487.1-575s1c1
Sequence:CCGGCCCAACGGAGTCAACCGTTTCCTCGAGGAAACGGTTGACTCCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078487.1-567s1c1
Sequence:CCGGGCGCGGATCCCAACGGAGTCACTCGAGTGACTCCGTTGGGATCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078487.1-532s1c1
Sequence:CCGGACTAGTGGAGAAGGTGCGACACTCGAGTGTCGCACCTTCTCCACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078487.1-579s1c1
Sequence:CCGGACGGAGTCAACCGTTTCGGGACTCGAGTCCCGAAACGGTTGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_078487
CDKN2B MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-2186s21c1
Sequence:CCGGCTCGTGGGATGTCCTACTATCCTCGAGGATAGTAGGACATCCCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3507s21c1
Sequence:CCGGCCTAATGACAACCTGATATTACTCGAGTAATATCAGGTTGTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3232s21c1
Sequence:CCGGCACTTAAGCACTCAATCATTACTCGAGTAATGATTGAGTGCTTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3737s21c1
Sequence:CCGGTTCATCAGCAGCCTAATATATCTCGAGATATATTAGGCTGCTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-2515s21c1
Sequence:CCGGTATGCTTCTAAATGCTCATTCCTCGAGGAATGAGCATTTAGAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3365s21c1
Sequence:CCGGCCCTTAATTTGACCTCTATATCTCGAGATATAGAGGTCAAATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-2322s21c1
Sequence:CCGGACTCCAAGAGGTGGGTAATTTCTCGAGAAATTACCCACCTCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-2246s21c1
Sequence:CCGGTCCAGGGTTGCTTGATCATTACTCGAGTAATGATCAAGCAACCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-1129s21c1
Sequence:CCGGAGCGGATTTCCAGGGATATTTCTCGAGAAATATCCCTGGAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3553s21c1
Sequence:CCGGTGGATCCCACAGTACTATATTCTCGAGAATATAGTACTGTGGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078487.1-575s1c1
Sequence:CCGGCCCAACGGAGTCAACCGTTTCCTCGAGGAAACGGTTGACTCCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078487.1-567s1c1
Sequence:CCGGGCGCGGATCCCAACGGAGTCACTCGAGTGACTCCGTTGGGATCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078487.1-532s1c1
Sequence:CCGGACTAGTGGAGAAGGTGCGACACTCGAGTGTCGCACCTTCTCCACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078487.1-579s1c1
Sequence:CCGGACGGAGTCAACCGTTTCGGGACTCGAGTCCCGAAACGGTTGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_078487
CDKN2B MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-2186s21c1
Sequence:CCGGCTCGTGGGATGTCCTACTATCCTCGAGGATAGTAGGACATCCCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3507s21c1
Sequence:CCGGCCTAATGACAACCTGATATTACTCGAGTAATATCAGGTTGTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3232s21c1
Sequence:CCGGCACTTAAGCACTCAATCATTACTCGAGTAATGATTGAGTGCTTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3737s21c1
Sequence:CCGGTTCATCAGCAGCCTAATATATCTCGAGATATATTAGGCTGCTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-2515s21c1
Sequence:CCGGTATGCTTCTAAATGCTCATTCCTCGAGGAATGAGCATTTAGAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3365s21c1
Sequence:CCGGCCCTTAATTTGACCTCTATATCTCGAGATATAGAGGTCAAATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-2322s21c1
Sequence:CCGGACTCCAAGAGGTGGGTAATTTCTCGAGAAATTACCCACCTCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-2246s21c1
Sequence:CCGGTCCAGGGTTGCTTGATCATTACTCGAGTAATGATCAAGCAACCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-1129s21c1
Sequence:CCGGAGCGGATTTCCAGGGATATTTCTCGAGAAATATCCCTGGAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078487.2-3553s21c1
Sequence:CCGGTGGATCCCACAGTACTATATTCTCGAGAATATAGTACTGTGGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078487.1-575s1c1
Sequence:CCGGCCCAACGGAGTCAACCGTTTCCTCGAGGAAACGGTTGACTCCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078487.1-567s1c1
Sequence:CCGGGCGCGGATCCCAACGGAGTCACTCGAGTGACTCCGTTGGGATCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078487.1-532s1c1
Sequence:CCGGACTAGTGGAGAAGGTGCGACACTCGAGTGTCGCACCTTCTCCACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078487.1-579s1c1
Sequence:CCGGACGGAGTCAACCGTTTCGGGACTCGAGTCCCGAAACGGTTGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks