EMAIL THIS PAGE TO A FRIEND

CDKN2C

cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)

Synonyms: INK4C p18 p18-INK4C
UniProtKB ID: P42773, Q8TB83
Gene ID:
Human(1031) Summary: The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to interact with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. Ectopic expression of this gene was shown to suppress the growth of human cells in a manner that appears to correlate with the presence of a wild-type RB1 function. Studies in the knockout mice suggested the roles of this gene in regulating spermatogenesis, as well as in suppressing tumorigenesis. Two alternatively spliced transcript variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008]
Mouse(12580) cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
Rat(54238) cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
Zebrafish(555797) cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
cow(505691) cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
domestic cat(101086582) cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
dog(475359) cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
chicken(429104) cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
sheep(101109224) cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
domestic guinea pig(100727634) cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
R7772 Roscovitine ≥98% (TLC) human, mouse, rat pricing
O0886 Olomoucine ≥98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001262 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU051031 MISSION® esiRNA esiRNA targeting mouse Cdkn2c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001262 Rosetta Predictions human pricing
NM_078626 Rosetta Predictions human pricing
NM_131902 Rosetta Predictions rat pricing
NM_007671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123642 predicted 1644
2 SASI_Hs01_00123644 predicted 1480
3 SASI_Hs01_00123645 predicted 1412
4 SASI_Hs02_00331449 predicted 1339
5 SASI_Hs02_00331450 predicted 1387
6 SASI_Hs02_00331451 predicted 1258
7 SASI_Hs01_00123649 predicted 1413
8 SASI_Hs02_00331452 predicted 1259
9 SASI_Hs01_00123650 predicted 1657
10 SASI_Hs02_00331453 predicted 1423
11 SASI_Hs01_00123641 predicted 1707
12 SASI_Hs01_00123643 predicted 1744
13 SASI_Hs01_00123646 predicted 1708
14 SASI_Hs01_00123647 predicted 1763
15 SASI_Hs01_00123648 predicted 1638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094842 predicted 830
2 SASI_Hs01_00094844 predicted 669
3 SASI_Hs01_00094845 predicted 599
4 SASI_Hs02_00362176 predicted 525
5 SASI_Hs02_00362177 predicted 574
6 SASI_Hs02_00362178 predicted 440
7 SASI_Hs01_00094849 predicted 592
8 SASI_Hs02_00362179 predicted 443
9 SASI_Hs01_00094850 predicted 841
10 SASI_Hs02_00362180 predicted 601
11 SASI_Hs01_00094841 predicted 885
12 SASI_Hs01_00094843 predicted 932
13 SASI_Hs01_00094846 predicted 892
14 SASI_Hs01_00094847 predicted 956
15 SASI_Hs01_00094848 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084855 predicted 647
2 SASI_Rn01_00084856 predicted 973
3 SASI_Rn02_00267528 predicted 698
4 SASI_Rn01_00084857 predicted 950
5 SASI_Rn01_00084858 predicted 700
6 SASI_Rn01_00084859 predicted 576
7 SASI_Rn01_00084860 predicted 800
8 SASI_Rn01_00084861 predicted 873
9 SASI_Rn01_00084864 predicted 650
10 SASI_Rn02_00267529 predicted 613
11 SASI_Rn01_00084862 predicted 1035
12 SASI_Rn01_00084863 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312180 predicted 389
2 SASI_Mm02_00312181 predicted 396
3 SASI_Mm02_00312182 predicted 391
4 SASI_Mm02_00312183 predicted 341
5 SASI_Mm02_00312184 predicted 350
6 SASI_Mm02_00312185 predicted 493
7 SASI_Mm02_00312186 predicted 271
8 SASI_Mm02_00312187 predicted 271
9 SASI_Mm02_00312188 predicted 570
10 SASI_Mm02_00312189 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001262
VALIDATED
CDKN2C MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001262.2-1740s1c1
Sequence:CCGGCCCACGTTGCCTCTACTTTATCTCGAGATAAAGTAGAGGCAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001262.2-1654s1c1
Sequence:CCGGCTATGGGAGGAATGAGGTTGTCTCGAGACAACCTCATTCCTCCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001262.2-1321s1c1
Sequence:CCGGTGGATTTGGAAGGACTGCGCTCTCGAGAGCGCAGTCCTTCCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001262.2-1464s1c1
Sequence:CCGGTGGACACTTTACAGACTTTGCCTCGAGGCAAAGTCTGTAAAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001262.2-1421s1c1
Sequence:CCGGACTGGTTTCGCTGTCATTCATCTCGAGATGAATGACAGCGAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001262.2-1499s21c1
Sequence:GTACCGGGATGTTAACATCGAGGATAATCTCGAGATTATCCTCGATGTTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001262.2-1740s21c1
Sequence:CCGGCCCACGTTGCCTCTACTTTATCTCGAGATAAAGTAGAGGCAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001262.2-1383s21c1
Sequence:CCGGTGCTACTTAGAGGTGCTAATCCTCGAGGATTAGCACCTCTAAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001262.2-1335s21c1
Sequence:CCGGCTGCGCTGCAGGTTATGAAACCTCGAGGTTTCATAACCTGCAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001262
VALIDATED
CDKN2C MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001262.2-1740s1c1
Sequence:CCGGCCCACGTTGCCTCTACTTTATCTCGAGATAAAGTAGAGGCAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001262.2-1654s1c1
Sequence:CCGGCTATGGGAGGAATGAGGTTGTCTCGAGACAACCTCATTCCTCCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001262.2-1321s1c1
Sequence:CCGGTGGATTTGGAAGGACTGCGCTCTCGAGAGCGCAGTCCTTCCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001262.2-1464s1c1
Sequence:CCGGTGGACACTTTACAGACTTTGCCTCGAGGCAAAGTCTGTAAAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001262.2-1421s1c1
Sequence:CCGGACTGGTTTCGCTGTCATTCATCTCGAGATGAATGACAGCGAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001262.2-1499s21c1
Sequence:GTACCGGGATGTTAACATCGAGGATAATCTCGAGATTATCCTCGATGTTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001262.2-1740s21c1
Sequence:CCGGCCCACGTTGCCTCTACTTTATCTCGAGATAAAGTAGAGGCAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001262.2-1383s21c1
Sequence:CCGGTGCTACTTAGAGGTGCTAATCCTCGAGGATTAGCACCTCTAAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001262.2-1335s21c1
Sequence:CCGGCTGCGCTGCAGGTTATGAAACCTCGAGGTTTCATAACCTGCAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001262
VALIDATED
CDKN2C MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001262.2-1740s1c1
Sequence:CCGGCCCACGTTGCCTCTACTTTATCTCGAGATAAAGTAGAGGCAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001262.2-1654s1c1
Sequence:CCGGCTATGGGAGGAATGAGGTTGTCTCGAGACAACCTCATTCCTCCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001262.2-1321s1c1
Sequence:CCGGTGGATTTGGAAGGACTGCGCTCTCGAGAGCGCAGTCCTTCCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001262.2-1464s1c1
Sequence:CCGGTGGACACTTTACAGACTTTGCCTCGAGGCAAAGTCTGTAAAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001262.2-1421s1c1
Sequence:CCGGACTGGTTTCGCTGTCATTCATCTCGAGATGAATGACAGCGAAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001262.2-1499s21c1
Sequence:GTACCGGGATGTTAACATCGAGGATAATCTCGAGATTATCCTCGATGTTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001262.2-1740s21c1
Sequence:CCGGCCCACGTTGCCTCTACTTTATCTCGAGATAAAGTAGAGGCAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001262.2-1383s21c1
Sequence:CCGGTGCTACTTAGAGGTGCTAATCCTCGAGGATTAGCACCTCTAAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001262.2-1335s21c1
Sequence:CCGGCTGCGCTGCAGGTTATGAAACCTCGAGGTTTCATAACCTGCAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007671
VALIDATED
CDKN2C MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007671.2-788s1c1
Sequence:CCGGCCGTTTCACTATCACTTATTACTCGAGTAATAAGTGATAGTGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007671.2-664s1c1
Sequence:CCGGCTATGGAAGAAATGAGGTCATCTCGAGATGACCTCATTTCTTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007671.2-407s1c1
Sequence:CCGGGCTAATCCCAATTTGAAAGATCTCGAGATCTTTCAAATTGGGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007671.2-352s1c1
Sequence:CCGGGCAGGTTATGAAACTTGGAAACTCGAGTTTCCAAGTTTCATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007671.2-786s21c1
Sequence:CCGGGTCCGTTTCACTATCACTTATCTCGAGATAAGTGATAGTGAAACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007671.2-667s21c1
Sequence:CCGGTGGAAGAAATGAGGTCATTAGCTCGAGCTAATGACCTCATTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007671.2-392s21c1
Sequence:CCGGCTTCTCCTCAGAGGTGCTAATCTCGAGATTAGCACCTCTGAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007671.2-496s21c1
Sequence:CCGGGGAGTTCCAGGCTGATGTTAACTCGAGTTAACATCAGCCTGGAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007671.2-341s21c1
Sequence:CCGGAGAACTGCGCTGCAGGTTATGCTCGAGCATAACCTGCAGCGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007671
VALIDATED
CDKN2C MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007671.2-788s1c1
Sequence:CCGGCCGTTTCACTATCACTTATTACTCGAGTAATAAGTGATAGTGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007671.2-664s1c1
Sequence:CCGGCTATGGAAGAAATGAGGTCATCTCGAGATGACCTCATTTCTTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007671.2-407s1c1
Sequence:CCGGGCTAATCCCAATTTGAAAGATCTCGAGATCTTTCAAATTGGGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007671.2-352s1c1
Sequence:CCGGGCAGGTTATGAAACTTGGAAACTCGAGTTTCCAAGTTTCATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007671.2-786s21c1
Sequence:CCGGGTCCGTTTCACTATCACTTATCTCGAGATAAGTGATAGTGAAACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007671.2-667s21c1
Sequence:CCGGTGGAAGAAATGAGGTCATTAGCTCGAGCTAATGACCTCATTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007671.2-392s21c1
Sequence:CCGGCTTCTCCTCAGAGGTGCTAATCTCGAGATTAGCACCTCTGAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007671.2-496s21c1
Sequence:CCGGGGAGTTCCAGGCTGATGTTAACTCGAGTTAACATCAGCCTGGAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007671.2-341s21c1
Sequence:CCGGAGAACTGCGCTGCAGGTTATGCTCGAGCATAACCTGCAGCGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007671
VALIDATED
CDKN2C MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007671.2-788s1c1
Sequence:CCGGCCGTTTCACTATCACTTATTACTCGAGTAATAAGTGATAGTGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007671.2-664s1c1
Sequence:CCGGCTATGGAAGAAATGAGGTCATCTCGAGATGACCTCATTTCTTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007671.2-407s1c1
Sequence:CCGGGCTAATCCCAATTTGAAAGATCTCGAGATCTTTCAAATTGGGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007671.2-352s1c1
Sequence:CCGGGCAGGTTATGAAACTTGGAAACTCGAGTTTCCAAGTTTCATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007671.2-786s21c1
Sequence:CCGGGTCCGTTTCACTATCACTTATCTCGAGATAAGTGATAGTGAAACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007671.2-667s21c1
Sequence:CCGGTGGAAGAAATGAGGTCATTAGCTCGAGCTAATGACCTCATTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007671.2-392s21c1
Sequence:CCGGCTTCTCCTCAGAGGTGCTAATCTCGAGATTAGCACCTCTGAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007671.2-496s21c1
Sequence:CCGGGGAGTTCCAGGCTGATGTTAACTCGAGTTAACATCAGCCTGGAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007671.2-341s21c1
Sequence:CCGGAGAACTGCGCTGCAGGTTATGCTCGAGCATAACCTGCAGCGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks