EMAIL THIS PAGE TO A FRIEND

CDKN2D

cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)

108 Gene Product Result for
Synonyms: INK4D p19 p19-INK4D
UniProtKB ID: P55273, Q13102, Q6FGE9
Gene ID:
Human(1032) Summary: The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to form a stable complex with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. The abundance of the transcript of this gene was found to oscillate in a cell-cycle dependent manner with the lowest expression at mid G1 and a maximal expression during S phase. The negative regulation of the cell cycle involved in this protein was shown to participate in repressing neuronal proliferation, as well as spermatogenesis. Two alternatively spliced variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008]
Mouse(12581) cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
Rat(494444) similar to cyclin-dependent kinase inhibitor 2D
domestic guinea pig(100717134) cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
naked mole-rat(101720531) cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
sheep(101118528) cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
dog(611216) cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
domestic cat(101091765) cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
cow(510244) cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
R7772 Roscovitine ≥98% (TLC) human, mouse, rat pricing
O0886 Olomoucine ≥98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_079421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_079421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_079421 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001800 Rosetta Predictions human pricing
NM_079421 Rosetta Predictions human pricing
NM_001009719 Rosetta Predictions rat pricing
NM_009878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195724 predicted 913
2 SASI_Hs01_00195725 predicted 914
3 SASI_Hs01_00195726 predicted 915
4 SASI_Hs01_00195727 predicted 630
5 SASI_Hs01_00195728 predicted 924
6 SASI_Hs01_00195729 predicted 654
7 SASI_Hs01_00195730 predicted 567
8 SASI_Hs01_00195731 predicted 665
9 SASI_Hs01_00195732 predicted 515
10 SASI_Hs02_00332576 predicted 652
11 SASI_Hs01_00195723 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_079421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053349 predicted 652
2 SASI_Hs01_00053350 predicted 657
3 SASI_Hs01_00053351 predicted 662
4 SASI_Hs01_00053352 predicted 373
5 SASI_Hs01_00053353 predicted 665
6 SASI_Hs01_00053354 predicted 395
7 SASI_Hs01_00053355 predicted 304
8 SASI_Hs01_00053356 predicted 416
9 SASI_Hs01_00053357 predicted 267
10 SASI_Hs02_00362187 predicted 397
11 SASI_Hs01_00053348 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009719 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085105 predicted 561
2 SASI_Rn01_00085106 predicted 792
3 SASI_Rn01_00085107 predicted 703
4 SASI_Rn01_00085109 predicted 809
5 SASI_Rn01_00085110 predicted 790
6 SASI_Rn01_00085111 predicted 710
7 SASI_Rn01_00085112 predicted 667
8 SASI_Rn01_00085113 predicted 387
9 SASI_Rn01_00085114 predicted 565
10 SASI_Rn02_00199786 predicted 729
11 SASI_Rn01_00085108 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317352 predicted 398
2 SASI_Mm01_00087490 predicted 547
3 SASI_Mm01_00087491 predicted 877
4 SASI_Mm01_00087492 predicted 776
5 SASI_Mm01_00087493 predicted 779
6 SASI_Mm01_00087494 predicted 463
7 SASI_Mm01_00087495 predicted 974
8 SASI_Mm01_00087496 predicted 964
9 SASI_Mm01_00087497 predicted 598
10 SASI_Mm01_00087498 predicted 607
11 SASI_Mm01_00087499 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009878
VALIDATED
CDKN2D MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009878.3-742s21c1
Sequence:CCGGACATGATGATCCCAATGTGACCTCGAGGTCACATTGGGATCATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009878.3-859s21c1
Sequence:CCGGAGGAGCAGTTTGTGGTTTATTCTCGAGAATAAACCACAAACTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009878.3-544s21c1
Sequence:CCGGAGCATGGTGCTGATGTCAATGCTCGAGCATTGACATCAGCACCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-810s1c1
Sequence:CCGGGCCATCTAAACGGTTCAGTTTCTCGAGAAACTGAACCGTTTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-457s1c1
Sequence:CCGGTCAGCTTCCTAGCTCCTGAATCTCGAGATTCAGGAGCTAGGAAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-540s1c1
Sequence:CCGGGCTCAGAACCTCATGGACATTCTCGAGAATGTCCATGAGGTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-427s1c1
Sequence:CCGGTGGCGATAAGAGAGGGCCATACTCGAGTATGGCCCTCTCTTATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-197s1c1
Sequence:CCGGCGCCCTGAACCGCTTTGGCAACTCGAGTTGCCAAAGCGGTTCAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009878
VALIDATED
CDKN2D MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009878.3-742s21c1
Sequence:CCGGACATGATGATCCCAATGTGACCTCGAGGTCACATTGGGATCATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009878.3-859s21c1
Sequence:CCGGAGGAGCAGTTTGTGGTTTATTCTCGAGAATAAACCACAAACTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009878.3-544s21c1
Sequence:CCGGAGCATGGTGCTGATGTCAATGCTCGAGCATTGACATCAGCACCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-810s1c1
Sequence:CCGGGCCATCTAAACGGTTCAGTTTCTCGAGAAACTGAACCGTTTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-457s1c1
Sequence:CCGGTCAGCTTCCTAGCTCCTGAATCTCGAGATTCAGGAGCTAGGAAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-540s1c1
Sequence:CCGGGCTCAGAACCTCATGGACATTCTCGAGAATGTCCATGAGGTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-427s1c1
Sequence:CCGGTGGCGATAAGAGAGGGCCATACTCGAGTATGGCCCTCTCTTATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-197s1c1
Sequence:CCGGCGCCCTGAACCGCTTTGGCAACTCGAGTTGCCAAAGCGGTTCAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009878
VALIDATED
CDKN2D MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009878.3-742s21c1
Sequence:CCGGACATGATGATCCCAATGTGACCTCGAGGTCACATTGGGATCATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009878.3-859s21c1
Sequence:CCGGAGGAGCAGTTTGTGGTTTATTCTCGAGAATAAACCACAAACTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009878.3-544s21c1
Sequence:CCGGAGCATGGTGCTGATGTCAATGCTCGAGCATTGACATCAGCACCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-810s1c1
Sequence:CCGGGCCATCTAAACGGTTCAGTTTCTCGAGAAACTGAACCGTTTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-457s1c1
Sequence:CCGGTCAGCTTCCTAGCTCCTGAATCTCGAGATTCAGGAGCTAGGAAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-540s1c1
Sequence:CCGGGCTCAGAACCTCATGGACATTCTCGAGAATGTCCATGAGGTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-427s1c1
Sequence:CCGGTGGCGATAAGAGAGGGCCATACTCGAGTATGGCCCTCTCTTATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009878.2-197s1c1
Sequence:CCGGCGCCCTGAACCGCTTTGGCAACTCGAGTTGCCAAAGCGGTTCAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_079421
VALIDATED
CDKN2D MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079421.2-300s21c1
Sequence:CCGGTGGATTCCTGGACACCCTGAACTCGAGTTCAGGGTGTCCAGGAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079421.2-403s21c1
Sequence:CCGGCACACTGCTGTGGTCAGCTTTCTCGAGAAAGCTGACCACAGCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_079421.2-977s21c1
Sequence:CCGGTAAGAAGGTAGAATGAGTTATCTCGAGATAACTCATTCTACCTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079421.2-375s21c1
Sequence:CCGGTCCAATCCATCTGGCAGTTCACTCGAGTGAACTGCCAGATGGATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079421.2-182s21c1
Sequence:CCGGCGCTGCAGGTCATGATGTTTGCTCGAGCAAACATCATGACCTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_079421.2-376s1c1
Sequence:CCGGCCAATCCATCTGGCAGTTCAACTCGAGTTGAACTGCCAGATGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079421.2-427s1c1
Sequence:CCGGGCAGCTGAATCTGATCTCCATCTCGAGATGGAGATCAGATTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079421.2-340s1c1
Sequence:CCGGGCTGATGTCAACGTGCCTGATCTCGAGATCAGGCACGTTGACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_079421.2-181s1c1
Sequence:CCGGGCGCTGCAGGTCATGATGTTTCTCGAGAAACATCATGACCTGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079421.2-156s1c1
Sequence:CCGGCGCCCTCAACCGCTTCGGCAACTCGAGTTGCCGAAGCGGTTGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_079421
VALIDATED
CDKN2D MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079421.2-300s21c1
Sequence:CCGGTGGATTCCTGGACACCCTGAACTCGAGTTCAGGGTGTCCAGGAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079421.2-403s21c1
Sequence:CCGGCACACTGCTGTGGTCAGCTTTCTCGAGAAAGCTGACCACAGCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_079421.2-977s21c1
Sequence:CCGGTAAGAAGGTAGAATGAGTTATCTCGAGATAACTCATTCTACCTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079421.2-375s21c1
Sequence:CCGGTCCAATCCATCTGGCAGTTCACTCGAGTGAACTGCCAGATGGATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079421.2-182s21c1
Sequence:CCGGCGCTGCAGGTCATGATGTTTGCTCGAGCAAACATCATGACCTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_079421.2-376s1c1
Sequence:CCGGCCAATCCATCTGGCAGTTCAACTCGAGTTGAACTGCCAGATGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079421.2-427s1c1
Sequence:CCGGGCAGCTGAATCTGATCTCCATCTCGAGATGGAGATCAGATTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079421.2-340s1c1
Sequence:CCGGGCTGATGTCAACGTGCCTGATCTCGAGATCAGGCACGTTGACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_079421.2-181s1c1
Sequence:CCGGGCGCTGCAGGTCATGATGTTTCTCGAGAAACATCATGACCTGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079421.2-156s1c1
Sequence:CCGGCGCCCTCAACCGCTTCGGCAACTCGAGTTGCCGAAGCGGTTGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_079421
VALIDATED
CDKN2D MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079421.2-300s21c1
Sequence:CCGGTGGATTCCTGGACACCCTGAACTCGAGTTCAGGGTGTCCAGGAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079421.2-403s21c1
Sequence:CCGGCACACTGCTGTGGTCAGCTTTCTCGAGAAAGCTGACCACAGCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_079421.2-977s21c1
Sequence:CCGGTAAGAAGGTAGAATGAGTTATCTCGAGATAACTCATTCTACCTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079421.2-375s21c1
Sequence:CCGGTCCAATCCATCTGGCAGTTCACTCGAGTGAACTGCCAGATGGATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_079421.2-182s21c1
Sequence:CCGGCGCTGCAGGTCATGATGTTTGCTCGAGCAAACATCATGACCTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_079421.2-376s1c1
Sequence:CCGGCCAATCCATCTGGCAGTTCAACTCGAGTTGAACTGCCAGATGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079421.2-427s1c1
Sequence:CCGGGCAGCTGAATCTGATCTCCATCTCGAGATGGAGATCAGATTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079421.2-340s1c1
Sequence:CCGGGCTGATGTCAACGTGCCTGATCTCGAGATCAGGCACGTTGACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_079421.2-181s1c1
Sequence:CCGGGCGCTGCAGGTCATGATGTTTCTCGAGAAACATCATGACCTGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_079421.2-156s1c1
Sequence:CCGGCGCCCTCAACCGCTTCGGCAACTCGAGTTGCCGAAGCGGTTGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks