EMAIL THIS PAGE TO A FRIEND

CDKN3

cyclin-dependent kinase inhibitor 3

101 Gene Product Result for
Synonyms: CDI1 CIP2 KAP KAP1
Gene ID:
Human(1033) Summary: The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(72391) cyclin-dependent kinase inhibitor 3
Rat(289993) cyclin-dependent kinase inhibitor 3
Zebrafish(402796) cyclin-dependent kinase inhibitor 3
chicken(423562) cyclin-dependent kinase inhibitor 3
cow(615282) cyclin-dependent kinase inhibitor 3
domestic cat(101100571) cyclin-dependent kinase inhibitor 3
dog(609346) cyclin-dependent kinase inhibitor 3
sheep(101116234) cyclin-dependent kinase inhibitor 3
naked mole-rat(101710612) cyclin-dependent kinase inhibitor 3
domestic guinea pig(100731849) cyclin-dependent kinase inhibitor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
R7772 Roscovitine ≥98% (TLC) human, mouse, rat pricing
O0886 Olomoucine ≥98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005192 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_354809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_354809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_354809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005192 siRNAs that have been validated in the lab human pricing
NM_001106028 Rosetta Predictions rat pricing
XM_891957 Rosetta Predictions mouse pricing
XM_899867 Rosetta Predictions mouse pricing
XM_899871 Rosetta Predictions mouse pricing
XM_919022 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005192 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143191 validated 603
1 SASI_Hs01_00143190 validated 366
1 SASI_Hs01_00143193 validated 249
2 SASI_Hs01_00143192 predicted 598
3 SASI_Hs02_00339141 predicted 590
4 SASI_Hs01_00143194 predicted 402
5 SASI_Hs01_00143195 predicted 488
6 SASI_Hs01_00143197 predicted 606
7 SASI_Hs02_00339142 predicted 264
8 SASI_Hs01_00143199 predicted 517
9 SASI_Hs01_00143196 predicted 437
10 SASI_Hs01_00143198 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214912 predicted 220
2 SASI_Rn02_00214913 predicted 340
3 SASI_Rn02_00214914 predicted 352
4 SASI_Rn02_00214915 predicted 324
5 SASI_Rn02_00214916 predicted 367
6 SASI_Rn02_00214917 predicted 339
7 SASI_Rn02_00214918 predicted 499
8 SASI_Rn02_00214919 predicted 358
9 SASI_Rn02_00214920 predicted 336
10 SASI_Rn02_00214921 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891957 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218868 predicted 256
2 SASI_Mm01_00218869 predicted 274
3 SASI_Mm01_00218870 predicted 231
4 SASI_Mm01_00218871 predicted 259
5 SASI_Mm01_00218872 predicted 260
6 SASI_Mm01_00218873 predicted 299
7 SASI_Mm01_00218874 predicted 244
8 SASI_Mm01_00218875 predicted 218
9 SASI_Mm01_00218876 predicted 247
10 SASI_Mm01_00218877 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255626 predicted 307
2 SASI_Mm01_00255628 predicted 232
3 SASI_Mm01_00255629 predicted 311
4 SASI_Mm01_00255630 predicted 248
5 SASI_Mm01_00255631 predicted 254
6 SASI_Mm01_00255632 predicted 292
7 SASI_Mm01_00255633 predicted 303
8 SASI_Mm01_00255635 predicted 305
9 SASI_Mm02_00430084 predicted 242
10 SASI_Mm02_00430085 predicted 223
11 SASI_Mm01_00255627 predicted 279
12 SASI_Mm01_00255634 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237120 predicted 497
2 SASI_Mm01_00237121 predicted 424
3 SASI_Mm01_00237122 predicted 370
4 SASI_Mm01_00237123 predicted 429
5 SASI_Mm01_00237124 predicted 457
6 SASI_Mm01_00237125 predicted 535
7 SASI_Mm01_00237126 predicted 513
8 SASI_Mm01_00237127 predicted 389
9 SASI_Mm01_00237128 predicted 536
10 SASI_Mm01_00237129 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_919022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442058 predicted 631
2 SASI_Mm02_00442059 predicted 562
3 SASI_Mm02_00442060 predicted 661
4 SASI_Mm02_00442061 predicted 206
5 SASI_Mm02_00442062 predicted 230
6 SASI_Mm02_00442063 predicted 636
7 SASI_Mm02_00442064 predicted 365
8 SASI_Mm02_00442065 predicted 406
9 SASI_Mm02_00442066 predicted 602
10 SASI_Mm02_00442067 predicted 595
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005192
VALIDATED
CDKN3 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005192.x-638s1c1
Sequence:CCGGCGGGACAAATTAGCTGCACATCTCGAGATGTGCAGCTAATTTGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005192.x-602s1c1
Sequence:CCGGCAGACCATCAAGCAATACAATCTCGAGATTGTATTGCTTGATGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005192.x-809s1c1
Sequence:CCGGGTGCAGATATTCCTAAAGTTTCTCGAGAAACTTTAGGAATATCTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005192.x-256s1c1
Sequence:CCGGAGAACTAAAGAGCTGTGGTATCTCGAGATACCACAGCTCTTTAGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005192.x-176s1c1
Sequence:CCGGTGTTCTCAGTTTCTCGGTTTACTCGAGTAAACCGAGAAACTGAGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005192.3-655s21c1
Sequence:CCGGCAGACCATCAAGCAATACAATCTCGAGATTGTATTGCTTGATGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005192.3-862s21c1
Sequence:CCGGGTGCAGATATTCCTAAAGTTTCTCGAGAAACTTTAGGAATATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005192.3-309s21c1
Sequence:CCGGAGAACTAAAGAGCTGTGGTATCTCGAGATACCACAGCTCTTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005192.3-229s21c1
Sequence:CCGGTGTTCTCAGTTTCTCGGTTTACTCGAGTAAACCGAGAAACTGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005192
VALIDATED
CDKN3 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005192.x-638s1c1
Sequence:CCGGCGGGACAAATTAGCTGCACATCTCGAGATGTGCAGCTAATTTGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005192.x-602s1c1
Sequence:CCGGCAGACCATCAAGCAATACAATCTCGAGATTGTATTGCTTGATGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005192.x-809s1c1
Sequence:CCGGGTGCAGATATTCCTAAAGTTTCTCGAGAAACTTTAGGAATATCTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005192.x-256s1c1
Sequence:CCGGAGAACTAAAGAGCTGTGGTATCTCGAGATACCACAGCTCTTTAGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005192.x-176s1c1
Sequence:CCGGTGTTCTCAGTTTCTCGGTTTACTCGAGTAAACCGAGAAACTGAGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005192.3-655s21c1
Sequence:CCGGCAGACCATCAAGCAATACAATCTCGAGATTGTATTGCTTGATGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005192.3-862s21c1
Sequence:CCGGGTGCAGATATTCCTAAAGTTTCTCGAGAAACTTTAGGAATATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005192.3-309s21c1
Sequence:CCGGAGAACTAAAGAGCTGTGGTATCTCGAGATACCACAGCTCTTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005192.3-229s21c1
Sequence:CCGGTGTTCTCAGTTTCTCGGTTTACTCGAGTAAACCGAGAAACTGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005192
VALIDATED
CDKN3 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005192.x-638s1c1
Sequence:CCGGCGGGACAAATTAGCTGCACATCTCGAGATGTGCAGCTAATTTGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005192.x-602s1c1
Sequence:CCGGCAGACCATCAAGCAATACAATCTCGAGATTGTATTGCTTGATGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005192.x-809s1c1
Sequence:CCGGGTGCAGATATTCCTAAAGTTTCTCGAGAAACTTTAGGAATATCTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005192.x-256s1c1
Sequence:CCGGAGAACTAAAGAGCTGTGGTATCTCGAGATACCACAGCTCTTTAGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005192.x-176s1c1
Sequence:CCGGTGTTCTCAGTTTCTCGGTTTACTCGAGTAAACCGAGAAACTGAGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005192.3-655s21c1
Sequence:CCGGCAGACCATCAAGCAATACAATCTCGAGATTGTATTGCTTGATGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005192.3-862s21c1
Sequence:CCGGGTGCAGATATTCCTAAAGTTTCTCGAGAAACTTTAGGAATATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005192.3-309s21c1
Sequence:CCGGAGAACTAAAGAGCTGTGGTATCTCGAGATACCACAGCTCTTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005192.3-229s21c1
Sequence:CCGGTGTTCTCAGTTTCTCGGTTTACTCGAGTAAACCGAGAAACTGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028222
CDKN3 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000454139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028222.1-597s21c1
Sequence:CCGGCATAGACAGCCTTCGAGATGTCTCGAGACATCTCGAAGGCTGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028222.1-235s21c1
Sequence:CCGGTGTGCTCTTCCAGGTTGTAAGCTCGAGCTTACAACCTGGAAGAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028222.1-678s21c1
Sequence:CCGGTAAATTAGCTGCGTATCTATCCTCGAGGATAGATACGCAGCTAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028222.1-731s21c1
Sequence:CCGGGATAATGAAGATCCCAAATAACTCGAGTTATTTGGGATCTTCATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028222
CDKN3 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000454139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028222.1-597s21c1
Sequence:CCGGCATAGACAGCCTTCGAGATGTCTCGAGACATCTCGAAGGCTGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028222.1-235s21c1
Sequence:CCGGTGTGCTCTTCCAGGTTGTAAGCTCGAGCTTACAACCTGGAAGAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028222.1-678s21c1
Sequence:CCGGTAAATTAGCTGCGTATCTATCCTCGAGGATAGATACGCAGCTAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028222.1-731s21c1
Sequence:CCGGGATAATGAAGATCCCAAATAACTCGAGTTATTTGGGATCTTCATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028222
CDKN3 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000454139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028222.1-597s21c1
Sequence:CCGGCATAGACAGCCTTCGAGATGTCTCGAGACATCTCGAAGGCTGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028222.1-235s21c1
Sequence:CCGGTGTGCTCTTCCAGGTTGTAAGCTCGAGCTTACAACCTGGAAGAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028222.1-678s21c1
Sequence:CCGGTAAATTAGCTGCGTATCTATCCTCGAGGATAGATACGCAGCTAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028222.1-731s21c1
Sequence:CCGGGATAATGAAGATCCCAAATAACTCGAGTTATTTGGGATCTTCATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_354809
VALIDATED
CDKN3 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase inhibitor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-144s1c1
Sequence:CCGGGATGAAGAACAGACTCCAATTCTCGAGAATTGGAGTCTGTTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-188s1c1
Sequence:CCGGGCGAGTGAATTGTTCCCAGTTCTCGAGAACTGGGAACAATTCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-548s1c1
Sequence:CCGGCCTATACTTGTCTGACTCAATCTCGAGATTGAGTCAGACAAGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-126s1c1
Sequence:CCGGTCAGACGAAGAACCTGTTGATCTCGAGATCAACAGGTTCTTCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-357s1c1
Sequence:CCGGCTTCTGGACCTCTACCAACAACTCGAGTTGTTGGTAGAGGTCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_354809
VALIDATED
CDKN3 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase inhibitor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-144s1c1
Sequence:CCGGGATGAAGAACAGACTCCAATTCTCGAGAATTGGAGTCTGTTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-188s1c1
Sequence:CCGGGCGAGTGAATTGTTCCCAGTTCTCGAGAACTGGGAACAATTCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-548s1c1
Sequence:CCGGCCTATACTTGTCTGACTCAATCTCGAGATTGAGTCAGACAAGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-126s1c1
Sequence:CCGGTCAGACGAAGAACCTGTTGATCTCGAGATCAACAGGTTCTTCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-357s1c1
Sequence:CCGGCTTCTGGACCTCTACCAACAACTCGAGTTGTTGGTAGAGGTCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_354809
VALIDATED
CDKN3 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase inhibitor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-144s1c1
Sequence:CCGGGATGAAGAACAGACTCCAATTCTCGAGAATTGGAGTCTGTTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-188s1c1
Sequence:CCGGGCGAGTGAATTGTTCCCAGTTCTCGAGAACTGGGAACAATTCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-548s1c1
Sequence:CCGGCCTATACTTGTCTGACTCAATCTCGAGATTGAGTCAGACAAGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-126s1c1
Sequence:CCGGTCAGACGAAGAACCTGTTGATCTCGAGATCAACAGGTTCTTCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354809.1-357s1c1
Sequence:CCGGCTTCTGGACCTCTACCAACAACTCGAGTTGTTGGTAGAGGTCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks