EMAIL THIS PAGE TO A FRIEND

CDNF

cerebral dopamine neurotrophic factor

52 Gene Product Result for
Synonyms: ARMETL1
UniProtKB ID: Q49AH0, A2RUU0, B4DVW3
Gene ID:
Mouse(227526) cerebral dopamine neurotrophic factor
Rat(361276) cerebral dopamine neurotrophic factor
domestic guinea pig(100728228) cerebral dopamine neurotrophic factor
sheep(101108409) cerebral dopamine neurotrophic factor
Zebrafish(100037317) cerebral dopamine neurotrophic factor
domestic cat(101098963) cerebral dopamine neurotrophic factor
Horse(100056424) cerebral dopamine neurotrophic factor
cow(513798) cerebral dopamine neurotrophic factor
dog(607252) cerebral dopamine neurotrophic factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1357 Human CDNF ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001029954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029954 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029954 Rosetta Predictions human pricing
NM_001037543 Rosetta Predictions rat pricing
NM_177647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054362 predicted 772
2 SASI_Hs01_00054363 predicted 758
3 SASI_Hs01_00054364 predicted 649
4 SASI_Hs01_00054365 predicted 750
5 SASI_Hs01_00054366 predicted 820
6 SASI_Hs01_00054367 predicted 652
7 SASI_Hs01_00054368 predicted 756
8 SASI_Hs01_00054369 predicted 878
9 SASI_Hs01_00054370 predicted 746
10 SASI_Hs01_00054371 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049946 predicted 351
2 SASI_Rn01_00049947 predicted 229
3 SASI_Rn01_00049948 predicted 301
4 SASI_Rn01_00049949 predicted 380
5 SASI_Rn01_00049951 predicted 292
6 SASI_Rn01_00049952 predicted 289
7 SASI_Rn02_00204482 predicted 354
8 SASI_Rn01_00049953 predicted 330
9 SASI_Rn01_00049954 predicted 210
10 SASI_Rn01_00049955 predicted 288
11 SASI_Rn01_00049950 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347907 predicted 1075
2 SASI_Mm02_00347908 predicted 253
3 SASI_Mm02_00347909 predicted 555
4 SASI_Mm02_00347910 predicted 640
5 SASI_Mm02_00347911 predicted 713
6 SASI_Mm02_00347912 predicted 855
7 SASI_Mm02_00347913 predicted 640
8 SASI_Mm02_00347914 predicted 383
9 SASI_Mm02_00347915 predicted 865
10 SASI_Mm02_00347916 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177647
CDNF MISSION shRNA Bacterial Glycerol Stock
cerebral dopamine neurotrophic factor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177647.2-217s1c1
Sequence:CCGGGCTAAGCAGAGGCATAGACTTCTCGAGAAGTCTATGCCTCTGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177647.2-1509s1c1
Sequence:CCGGCCAACCAATGAACCAACCAAACTCGAGTTTGGTTGGTTCATTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177647.2-397s1c1
Sequence:CCGGGATTTGTGAGAAGCTAAAGAACTCGAGTTCTTTAGCTTCTCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177647.2-560s1c1
Sequence:CCGGGACTACGTGAACCTCATTAGACTCGAGTCTAATGAGGTTCACGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177647.2-497s1c1
Sequence:CCGGGCAGAGCTAAAGCAGATCCTTCTCGAGAAGGATCTGCTTTAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198357    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177647.2-866s1c1
Sequence:CCGGGCCTTTGCATTGCTATGACAACTCGAGTTGTCATAGCAATGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177647.2-427s1c1
Sequence:CCGGCCAGATCTGTGAGCTGAAATACTCGAGTATTTCAGCTCACAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177647.2-2377s1c1
Sequence:CCGGGCAGGATTTCTCTGTATAGTTCTCGAGAACTATACAGAGAAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177647
CDNF MISSION shRNA shRNA Plasmid DNA
cerebral dopamine neurotrophic factor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177647.2-217s1c1
Sequence:CCGGGCTAAGCAGAGGCATAGACTTCTCGAGAAGTCTATGCCTCTGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177647.2-1509s1c1
Sequence:CCGGCCAACCAATGAACCAACCAAACTCGAGTTTGGTTGGTTCATTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177647.2-397s1c1
Sequence:CCGGGATTTGTGAGAAGCTAAAGAACTCGAGTTCTTTAGCTTCTCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177647.2-560s1c1
Sequence:CCGGGACTACGTGAACCTCATTAGACTCGAGTCTAATGAGGTTCACGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177647.2-497s1c1
Sequence:CCGGGCAGAGCTAAAGCAGATCCTTCTCGAGAAGGATCTGCTTTAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198357    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177647.2-866s1c1
Sequence:CCGGGCCTTTGCATTGCTATGACAACTCGAGTTGTCATAGCAATGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177647.2-427s1c1
Sequence:CCGGCCAGATCTGTGAGCTGAAATACTCGAGTATTTCAGCTCACAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177647.2-2377s1c1
Sequence:CCGGGCAGGATTTCTCTGTATAGTTCTCGAGAACTATACAGAGAAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177647
CDNF MISSION shRNA Lentiviral Transduction Particles
cerebral dopamine neurotrophic factor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177647.2-217s1c1
Sequence:CCGGGCTAAGCAGAGGCATAGACTTCTCGAGAAGTCTATGCCTCTGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177647.2-1509s1c1
Sequence:CCGGCCAACCAATGAACCAACCAAACTCGAGTTTGGTTGGTTCATTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177647.2-397s1c1
Sequence:CCGGGATTTGTGAGAAGCTAAAGAACTCGAGTTCTTTAGCTTCTCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177647.2-560s1c1
Sequence:CCGGGACTACGTGAACCTCATTAGACTCGAGTCTAATGAGGTTCACGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177647.2-497s1c1
Sequence:CCGGGCAGAGCTAAAGCAGATCCTTCTCGAGAAGGATCTGCTTTAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198357    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177647.2-866s1c1
Sequence:CCGGGCCTTTGCATTGCTATGACAACTCGAGTTGTCATAGCAATGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177647.2-427s1c1
Sequence:CCGGCCAGATCTGTGAGCTGAAATACTCGAGTATTTCAGCTCACAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177647.2-2377s1c1
Sequence:CCGGGCAGGATTTCTCTGTATAGTTCTCGAGAACTATACAGAGAAATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029954
VALIDATED
CDNF MISSION shRNA Bacterial Glycerol Stock
cerebral dopamine neurotrophic factor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029954.2-347s1c1
Sequence:CCGGGAGTGTGCATATGCCTGCAATCTCGAGATTGCAGGCATATGCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029954.2-402s1c1
Sequence:CCGGCAGATCTGTGAGCTGAAATATCTCGAGATATTTCAGCTCACAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029954.2-371s1c1
Sequence:CCGGGATTTGTGAGAAGCTGAAGAACTCGAGTTCTTCAGCTTCTCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001029954.2-173s1c1
Sequence:CCGGCCGATTCTACAAGTCACTGATCTCGAGATCAGTGACTTGTAGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029954.2-378s1c1
Sequence:CCGGGAGAAGCTGAAGAAGTTGGATCTCGAGATCCAACTTCTTCAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029954.2-142s1c1
Sequence:CCGGCCGACTGTGAAGTATGTAAAGCTCGAGCTTTACATACTTCACAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029954.2-276s1c1
Sequence:CCGGCGCCTGTGCTATTATCTAGGACTCGAGTCCTAGATAATAGCACAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029954
VALIDATED
CDNF MISSION shRNA shRNA Plasmid DNA
cerebral dopamine neurotrophic factor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029954.2-347s1c1
Sequence:CCGGGAGTGTGCATATGCCTGCAATCTCGAGATTGCAGGCATATGCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029954.2-402s1c1
Sequence:CCGGCAGATCTGTGAGCTGAAATATCTCGAGATATTTCAGCTCACAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029954.2-371s1c1
Sequence:CCGGGATTTGTGAGAAGCTGAAGAACTCGAGTTCTTCAGCTTCTCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001029954.2-173s1c1
Sequence:CCGGCCGATTCTACAAGTCACTGATCTCGAGATCAGTGACTTGTAGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029954.2-378s1c1
Sequence:CCGGGAGAAGCTGAAGAAGTTGGATCTCGAGATCCAACTTCTTCAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029954.2-142s1c1
Sequence:CCGGCCGACTGTGAAGTATGTAAAGCTCGAGCTTTACATACTTCACAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029954.2-276s1c1
Sequence:CCGGCGCCTGTGCTATTATCTAGGACTCGAGTCCTAGATAATAGCACAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029954
VALIDATED
CDNF MISSION shRNA Lentiviral Transduction Particles
cerebral dopamine neurotrophic factor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029954.2-347s1c1
Sequence:CCGGGAGTGTGCATATGCCTGCAATCTCGAGATTGCAGGCATATGCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029954.2-402s1c1
Sequence:CCGGCAGATCTGTGAGCTGAAATATCTCGAGATATTTCAGCTCACAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029954.2-371s1c1
Sequence:CCGGGATTTGTGAGAAGCTGAAGAACTCGAGTTCTTCAGCTTCTCACAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001029954.2-173s1c1
Sequence:CCGGCCGATTCTACAAGTCACTGATCTCGAGATCAGTGACTTGTAGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029954.2-378s1c1
Sequence:CCGGGAGAAGCTGAAGAAGTTGGATCTCGAGATCCAACTTCTTCAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029954.2-142s1c1
Sequence:CCGGCCGACTGTGAAGTATGTAAAGCTCGAGCTTTACATACTTCACAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029954.2-276s1c1
Sequence:CCGGCGCCTGTGCTATTATCTAGGACTCGAGTCCTAGATAATAGCACAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks